Control of Gene Expression

Back

 

The giant transgenic mouse on the left was produced by injecting a rat gene for growth hormone into a mouse embryo; a normal-size mouse is on the right. To ensure expression, the rat gene was linked to a DNA sequence that stimulates the transcription of mouse DNA whenever heavy metals are pre­sent. Zinc was provided in the food for the transgenic mouse; some transgenic mice produced 800 times the normal levels of growth hormone. (Courtesy of Dr. Ralph L. Brinster, School of Veterinary Medicine, University of Pennsylvania.)

Creating Giant Mice Through Gene Regulation

General Principles of Gene Regulation

Levels of Gene Control Genes and Regulatory Elements DNA-Binding Proteins Gene Regulation in Bacterial Cells Operon Structure Negative and Positive Control: Inducible and Repressible Operons The lac Operon of E. coli lac Mutations Positive Control and Catabolite Repression The trp Operon of E. coli

Attenuation: The Premature Termination of Transcription

Antisense RNA in Gene Regulation

Transcriptional Control in Bacteriophage Lambda

Eukaryotic Gene Regulation

Chromatin Structure and Gene Regulation

Transcriptional Control in Eukaryotic Cells Gene Control

Through Messenger RNA Processing Gene Control Through RNA Stability RNA Silencing

Translational and Posttranslational Control

Creating Giant Mice Through Gene Regulation

In 1982, a group of molecular geneticists led by Richard Palmiter at the University of Washington produced gigantic mice that grew to almost twice the size of normal mice. Palmiter and his colleagues created these large mice through genetic engineering, by injecting the rat gene for growth hormone into the nuclei of fertilized mouse embryos and then implanting these embryos into surrogate mouse moth­ers. In a few embryos, the rat gene became incorporated into the mouse chromosome and, after birth, these trans-

genic mice produced growth hormone encoded by the rat gene. Some of the transgenic mice produced from 100 to 800 times the amount of growth hormone found in normal mice, which caused them to grow rapidly into giants.

Inserting foreign genes into bacteria, plants, mice, and even humans is now a routine procedure for molecular geneticists (see Chapter 18). However, simply putting a gene into a cell does not guarantee that the gene will be tran­scribed or produce a protein; indeed, most foreign genes are never transcribed or translated, which isn't surprising. Organisms have evolved complex systems to ensure that genes are expressed at the appropriate time and in the

appropriate amounts, and sequences other than the gene itself are required to ensure transcription and translation. In this chapter, we will learn more about these sequences and other mechanisms that control gene expression.

If foreign genes are rarely expressed, why did the trans- genic mice with the gene for rat growth hormone grow so big? Palmiter and his colleagues, aware of the need to pro­vide sequences that control gene expression, linked the rat gene with the mouse metallothionein I promoter sequence, a DNA sequence normally found upstream of the mouse metallothionein I gene. When heavy metals such as zinc are present, they activate the metallothionein promoter sequence, thereby stimulating transcription of the metal- lothionein I gene. By connecting the rat growth-hormone gene to this promoter, Palmiter and his colleagues provided a means of turning on the transcription of the gene, simply by putting extra zinc in the food for the transgenic mice.

This chapter is about gene regulation, the mechanisms and systems that control the expression of genes. We begin by discussing why gene regulation is necessary; the levels at which gene expression is controlled; and the difference between genes and regulatory elements. We then examine gene regulation in bacterial cells. In the second half of the chapter, we turn to gene regulation in eukaryotic cells, which is often more complex than in bacterial cells.

General Principles of Gene Regulation

One of the major themes of molecular genetics is the central dogma, which stated that genetic information flows from DNA to RNA to proteins (see Figure 10.17a) and pro­vided a molecular basis for the connection between geno­type and phenotype. Although the central dogma brought coherence to early research in molecular genetics, it failed to address a critical issue: How is the flow of information along the molecular pathway regulated?

Consider E. coli, a bacterium that resides in your large intestine. Your eating habits completely determine the nutrients available to this bacteria: it can't seek out nourish­ment when nutrients are scarce; nor can it move away when confronted with unpleasant changes. E. coli makes up for its inability to alter the external environment by being inter­nally flexible. For example, if glucose is present, E. coli uses it to generate ATP; if there's no glucose, it utilizes lactose, arabinonse, maltose, xylose, or any of a number of other sugars. When amino acids are available, E. coli uses them to synthesize proteins; if a particular amino acid is absent, E. coli produces the enzymes needed to synthesize that amino acid. Thus, E. coli responds to environmental changes by rapidly altering its biochemistry. This biochemical flexi­bility, however, has a high price. Producing all the enzymes necessary for every environmental condition would be ener­getically expensive. So how does E. coli maintain biochemical flexibility while optimizing energy efficiency?

The answer is through gene regulation. Bacteria carry the genetic information for many proteins, but only a subset of this genetic information is expressed at any time. When the environment changes, new genes are expressed, and proteins appropriate for the new environment are syn­thesized. For example, if a carbon source appears in the environment, genes encoding enzymes that take up and metabolize this carbon source are quickly transcribed and translated. When this carbon source disappears, the genes that encode them are shut off. This type of response, the synthesis of an enzyme stimulated by a specific substrate, is called induction.

Multicellular eukaryotic organisms face a different dilemma. Individual cells in a multicellular organism are specialized for particular tasks. The proteins produced by a nerve cell, for example, are quite different from those pro­duced by a white blood cell. The problem that a eukaryotic cell faces is how to specialize. Although they are quite differ­ent in shape and function, a nerve cell and a blood cell still carry the same genetic instructions.

A multicellular organism's challenge is to bring about the specialization of cells that have a common set of genetic instructions. This challenge is met through gene regulation: all of an organism's cells carry the same genetic informa­tion, but only a subset of genes are expressed in each cell type. Genes needed for other cell types are not expressed. Gene regulation is therefore the key to both unicellular flex­ibility and multicellular specialization, and it is critical to the success of all living organisms.

Concepts       9

In bacteria, gene regulation maintains internal flexibility, turning genes on and off in response to environmental changes. In multicellular eukaryotic organisms, gene regulation brings about cellular differentiation.

Levels of Gene Control

A gene may be regulated at a number of points along the pathway of information flow from genotype to phenotype (< Figure 16.1). First, regulation may be through the alter­ation of gene structure. Modifications to DNA or its pack­aging may influence which sequences are available for transcription or the rate at which sequences are transcribed. DNA methylation and changes in chromatin are two processes that play a pivotal role in gene regulation.

A second point at which a gene can be regulated is at the level of transcription. For the sake of cellular economy, it makes sense to limit protein production early in the transfer of information from DNA to protein, and tran­scription is an important point of gene regulation in both bacterial and eukaryotic cells. A third potential point of gene regulation is mRNA processing. Eukaryotic mRNA is

Compact DNA

Levels of gene control

 

 

 

 

 

Alteration of structure

Relaxed DNA '

 

 

 

An

 

 

 

Transcription

 

 

Pre-mRNA

 

 

 

mRNA processing

Processed mRNA

 

RNA stability

Translation

Protein (inactive)

 

Posttranslational modification

Modified protein (active)

4 16.1 Gene expression may be controlled at multiple levels.

extensively modified before it is translated; a 5' cap is added, the 3' end is cleaved and polyadenylated, and introns are removed (see Chapter 14). These modifications deter­mine the stability of the mRNA, whether mRNA can be translated, the rate of translation, and the amino acid sequence of the protein produced. There is growing evi­dence that a number of regulatory mechanisms in eukary- otic cells operate at the level of mRNA processing.

A fourth point for the control of gene expression is the regulation of RNA stability. The amount of protein produced depends not only on the amount of mRNA syn­thesized, but also on the rate at which the mRNA is degraded; so RNA stability plays an important role in gene expression. A fifth point of gene regulation is at the level of translation, a complex process requiring a large number of enzymes, protein factors, and RNA molecules (Chapter 15).

All of these factors, as well as the availability of amino acids and sequences in mRNA, influence the rate at which pro­teins are produced and therefore provide points at which gene expression may be controlled.

Finally, many proteins are modified after translation (Chapter 13), and these modifications affect whether the proteins become active; so genes can be regulated through processes that affect posttranscriptional modification. Gene expression may be affected by regulatory activities at any or all of these points.

Concepts]"

Gene expression may be controlled at any of a number of points along the molecular pathway from DNA to protein, including gene structure, transcription, mRNA processing, RNA stability, translation, and posttranslational modification.

 

Genes and Regulatory Elements

In our consideration of gene regulation, it will be necessary to distinguish between the DNA sequences that are tran­scribed and the DNA sequences that regulate the expression of other sequences. We will refer to any DNA sequence that is transcribed into an RNA molecule as a gene. According to this definition, genes include DNA sequences that encode proteins, as well as sequences that encode rRNA, tRNA, snRNA, and other types of RNA. Structural genes encode proteins that are used in metabolism or biosynthesis or that play a structural role in the cell. Regulatory genes are genes whose products, either RNA or proteins, interact with other sequences and affect their transcription or translation. In many cases, the products of regulatory genes are DNA- binding proteins.

We will also encounter DNA sequences that are not transcribed at all but still play a role in regulating other nucleotide sequences. These regulatory elements affect the expression of sequences to which they are physically linked. Much of gene regulation takes place through the action of proteins produced by regulatory genes that recognize and bind to regulatory elements.

Concepts)"

Genes are DNA sequences that are transcribed into RNA. Regulatory elements are DNA sequences that are not transcribed but affect the expression of genes.

 

DNA-Binding Proteins

Much of gene regulation is accomplished by proteins that bind to DNA sequences and influence their expression. These regulatory proteins generally have discrete functional

(a) Helix-turn-helix    (b) Zinc fingers          (c) Steroid receptor

Helix Turn Helix

\ u /

 

DNA-  Turn Dimer-

binding helix  binding helix

(d) Leucine zipper

 

(e) Helix-loop-helix

(f) Homeodomain

 

16.2 DNA-binding proteins can be grouped into several types on the basis of their structure, or motif. (a) The helix-turn-helix DNA motif consists of two alpha helices connected by a turn. (b) The zinc-finger motif consists of a loop of amino acids containing a single zinc ion. Most proteins containing zinc fingers have several repeats of the zinc-finger motif. Each zinc finger fits into the major groove of DNA and forms hydrogen bonds with bases in the DNA. (c) The steroid receptor binding motif has two alpha helices, each with a zinc ion surrounded by four cysteine residues. The two alpha helices are perpendicular to one another: one fits into the major groove of the double helix, whereas the other is parallel to the DNA. (d) The leucine-zipper motif consists of a helix of leucine nucleotides and an arm of basic amino acids. DNA-binding proteins usually have two polypeptides; the leucine nucleotides of the two polypeptides face one another, whereas the basic amino acids bind to the DNA. (e) The helix-loop-helix binding motif consists of two alpha helices separated by a loop of amino acids. Two polypeptide chains with this motif join to form a functional DNA-binding protein. A highly basic set of amino acids in one of the helices binds to the DNA. (f) The homeodomain motif consists of three alpha helices; the third helix fits in a major groove of DNA.

parts—called domains, typically consisting of 60 to 90 amino acids—that are responsible for binding to DNA. Within a domain, only a few amino acids actually make contact with the DNA. These amino acids (most commonly asparagine, glutamine, glycine, lysine, and arginine) often form hydrogen bonds with the bases or interact with the sugar-phosphate backbone of the DNA. Many regulatory proteins have additional domains that can bind other mole­cules such as other regulatory proteins.

DNA-binding proteins can be grouped into several dis­tinct types on the basis of a characteristic structure, called a motif, found within the binding domain. Motifs are simple structures, such as alpha helices, that can fit into the major groove of the DNA. Some common DNA-binding motifs are illustrated in 4 Figure 16.2 and are summarized in Table 16.1.

www.whfreeman.com/pierce Molecular images of several DNA-binding proteins

Table 16.1 Common DNA-binding motifs

Motif

Location

Characteristics

Binding Site in DNA

Helix-turn-helix

Bacterial regulatory proteins; related motifs in eukaryotic proteins

Two alpha helices

Major groove

Zinc-finger

Eukaryotic regulatory and other proteins

Loop of amino acids with zinc at base

Major groove

Steroid receptor

Eukaryotic proteins

Two perpendicular alpha helices with zinc surrounded by four cysteine residues

Major groove and DNA backbone

Leucine-zipper

Eukaryotic

Helix of leucine residues and

Two adjacent

 

transcription factors

a basic arm; two leucine residues interdigitate

major grooves

Helix-loop-helix

Eukaryotic proteins

Two alpha helices separated by a loop of amino acids

Major groove

Homeodomain

Eukaryotic regulatory proteins

Three alpha helices

Major groove

Gene Regulation in Bacterial Cells

The mechanisms of gene regulation were first investigated in bacterial cells, where the availability of mutants and the ease of laboratory manipulation made it possible to unravel the mechanisms. When the study of these mechanisms in eukaryotic cells began, it seemed clear that bacterial and eukaryotic gene regulation were quite different. As more and more information has accumulated about gene regula­tion, however, a number of common themes have emerged, and today many aspects of gene regulation in bacterial and eukaryotic cells are recognized to be similar. Although we will look at gene regulation in these two cell types sepa­rately, the emphasis will be on the common themes that apply to all cells.

Operon Structure

One significant difference in prokaryotic and eukaryotic gene control lies in the organization of functionally related genes. Many bacterial genes that have related functions are clustered and are under the control of a single promoter. These genes are often transcribed together into a single mRNA. Eukaryotic genes, in contrast, are dispersed, and typically, each is transcribed into a separate mRNA. A group of bacterial structural genes that are transcribed together (along with their promoter and additional sequences that control transcription) is called an operon.

The organization of a typical operon is illustrated in 4 Figure 16.3. At one end of the operon is a set of structural genes, shown in Figure 16.3 as gene a, gene b, and gene c. These structural genes are transcribed into a single mRNA, which is translated to produce enzymes A, B, and C. These

enzymes carry out a series of biochemical reactions that convert precursor molecule X into product Y. The tran­scription of structural genes a, b, and c is under the control of a promoter, which lies upstream of the first structural gene. RNA polymerase binds to the promoter and then moves downstream, transcribing the structural genes.

A regulator gene helps to regulate the transcription of the structural genes of the operon. The regulator gene is not considered part of the operon, although it affects operon function. The regulator gene has its own promoter and is transcribed into a relatively short mRNA, which is trans­lated into a small protein. This regulator protein may bind to a region of DNA called the operator and affect whether transcription can take place. The operator usually overlaps the 3' end of the promoter and sometimes the 5' end of the first structural gene (see Figure 16.3).

Concepts       9

Functionally related genes in bacterial cells are frequently clustered together as a single transcriptional unit termed an operon. A typical operon includes several structural genes, a promoter for the structural genes, and an operator site where the product of a regulator gene binds.

Negative and Positive Control: Inducible and Repressible Operons

There are two types of transcriptional control: negative con­trol, in which a regulatory protein acts as a repressor, binding to DNA and inhibiting transcription; and positive control, in

| An operon is a group of structural genes plus sequences that control transcription.

Operon

Operator

Regulator gene

a

A separate regulator gene— f with its own promoter—...

mRNA

 

 

Transcription

 

 

 

 

a

.encodes a regulator protein.

 

Regulator protein

 

Translation

4 16.3 An operon is a single transcriptional unit that includes a series of structural genes, a promoter, and an operator.

.that may bind to the operator site to regulate the transcription.

Transcription

mRNA

of mRNA,

Proteins (enzymes)

^          /I         

16 .whose products catalyze reactions in a biochemical pathway.

i

r

 

 

Translation

A         B         C

Biochemical pathway

Precursor X

^          K        

17 In some operons, product molecules may, in turn, bind to the regulator protein to either activate it or turn it off.

*■ A-

Intermediate products

Product Y

which a regulatory protein acts as an activator, stimulating transcription. In the next sections, we will consider several varieties of these two basic control mechanisms.

Negative inducible operons In an operon with negative control at the operator site, the regulatory protein is a repressor—the binding of the regulator protein to the operator inhibits transcription. In a negative inducible operon, transcription and translation of the regulator gene produce an active repressor that readily binds to the opera­tor (< Figure 16.4a). Because the operator site overlaps with the promoter site, the binding of this protein to the opera­tor physically blocks the binding of RNA polymerase to the promoter and prevents transcription. For transcription to take place, something must happen to prevent the binding of the repressor at the operator site. This type of system is said to be inducible, because transcription is normally off (inhibited) and must be turned on (induced).

Transcription is turned on when a small molecule, an inducer, binds to the repressor. < Figure 16.4b shows that, when precursor V (acting as the inducer) binds to the repressor, the repressor can no longer bind to the operator. Regulatory proteins frequently have two binding sites: one that binds to DNA and another that binds to a small mole­cule such as an inducer. Binding of the inducer alters the shape of the repressor, preventing it from binding to DNA. Proteins of this type, which change shape on binding to another molecule, are called allosteric proteins.

When the inducer is absent, the repressor binds to the operator, the structural genes are not transcribed, and enzymes D, E, and F (which metabolize precursor V) are not synthesized (see Figure 16.4a). This is an adaptive mechanism: because no precursor V is available, it would be wasteful for the cell to synthesize the enzymes when they have no substrate to metabolize. As soon as precursor V becomes available, some of it binds to the repressor, render­ing the repressor inactive and unable to bind to the opera­tor site. Now RNA polymerase can bind to the promoter and transcribe the structural genes. The resulting mRNA is then translated into enzymes D, E, and F, which convert substrate V into product W (see Figure 16.4b). So, an operon with negative inducible control regulates the synthe­sis of the enzymes economically: the enzymes are synthe­sized only when their substrate (V) is available.

Negative repressible operons Some operons with neg­ative control are repressible, meaning that transcription normally takes place and must be turned off, or repressed. The regulator protein in this type of operon also is a repres- sor but is synthesized in an inactive form that cannot by itself bind to the operator. Because there is no repressor bound to the operator, RNA polymerase readily binds to the promoter and transcription of the structural genes takes place (< Figure 16.5a).

To turn transcription off, something must happen to make the repressor active. A small molecule called a core-

Negative inducible operon

(a)

No precursor present

Regulator gene

Promote

^ The regulator protein is a repressor, produced in an active form,.

regulator protein

Operon

Operator

RNA

polymerase

 

~ Structural genes Cannot x ,         ——*  

bind     Gene d Gene e Gene f

Promoter

No transcription

^         

13 .and prevents transcription of the structural genes.

(b)

Precursor V (the inducer) present

Operator

^ When precursor V is present, it binds to the regulator protein and makes the regulator protein inactive.

 

Active regulator protein

Precursor V

A-

Intermediate products

Product W

4 16.4 Some operons are inducible.

Conclusion: The operon is turned on (and produces product W) only when precursor, V, is available.

pressor binds to the repressor and makes it capable of bind­ing to the operator. In the example illustrated (see Figure 16.5a), the product (U) of the metabolic reaction is the corepressor. As long as the level of product U is high, it is available to bind to and activate the repressor, preventing transcription (< Figure 16.5b). With the operon repressed, enzymes G, H, and I are not synthesized, and no more U is produced from precursor T. However, when all of product U is used up, the repressor is no longer activated by U and can­not bind to the operator. The inactivation of the repressor allows the transcription of the structural genes and the syn­thesis of enzymes G, H, and I, resulting in the conversion of precursor T into product U.

As with inducible operons, repressible operons are eco­nomical: the enzymes are synthesized only as needed. Note that both the inducible and the repressible systems that we have considered are forms of negative control, in which the regulatory protein is a repressor. We will now consider positive control, in which a regulator protein stimulates transcription.

Positive control With positive control, a regulatory pro­tein binds to DNA (usually at a site other than the operator)

and stimulates transcription. Theoretically, positive control could be inducible or repressible.

In a positive inducible operon, transcription would normally be turned off because the regulator protein would be produced in an inactive form. Transcription would take place when an inducer became attached to the regulatory protein, rendering the regulator active. Logi­cally, the inducer should be the precursor of the reaction controlled by the operon so that the necessary enzymes would be synthesized only when the substrate for their reaction was present.

A positive operon could also be repressible; transcrip­tion would normally take place and would have to be repressed. In this case, the regulator protein would be pro­duced in a form that readily binds to DNA and stimulates transcription. Transcription would be inhibited when a sub­stance became attached to the activator and rendered it unable to bind to the DNA so that transcription was no longer stimulated. Here, the product (P) of the reaction controlled by the operon would logically be the repressing substance, because it would be economical for the cell to prevent the transcription of genes that allow the synthesis of P when plenty of P is already available.

Negative repressible operon

Operator

(a)

No product U present

Regulator gene

RNA polymerase

Operon

Structural genes

Gene g Gene h Gene i

 

Inactive regulator protein (repressor)

(b)

Product U present

Inactive regulator protein (repressor)

Active regulator

protein ♦.

Biochemical pathway

Precursor T

Intermediate products

Product U (corepressor)

RNA

polymerase

/^Cannot" „ bind

Operator

 

Product U (corepressor)

4 16.5 Some operons are repressible.

Putting it all together Theoretically, operons might exhibit positive or negative control and be either inducible or repressible. Try sketching out all possible types— negative inducible, negative repressible, positive inducible, and positive repressible. To do so, learn the meanings of positive and negative control and inducible and repressible; then use logic to work out the details of whether the regu­latory protein is a repressor or an activator and whether it is produced in an active or inactive form. You can check your answers against Table 16.2, where the important features of these four types of operons are summarized. Another useful exercise is to think about the effects of mutations at various sites in different types of operon systems.

Although it is a useful learning device to think of operons as either positive or negative and either inducible or repressive, in reality both positive and negative con­trols often exist in the same operon.

Concepts       S

There are two basic types of transcriptional control: negative and positive. In negative control, when a regulatory protein (repressor) binds to DNA, transcription is inhibited; in positive control, when a regulatory protein (activator) binds to DNA, transcription is stimulated. Some operons are inducible; transcription is normally off and must be turned on. Other operons are repressible; transcription is normally on and must be turned off.

The lac Operon of E. coli

In 1961, Francois Jacob and Jacques Monod described the "operon model" for the genetic control of lactose metabo­lism in E. coli. This work and subsequent research on the genetics of lactose metabolism established the operon as

Table 16.2 Features of inducible and repressible operons with positive and negative control

 

 

 

Effect of

 

 

Transcription

 

Regulatory

Action of

Type of Control

Normally

Regulator Protein

Protein

Modulator

Negative inducible

Off

Active repressor

Inhibits

Substrate makes

 

 

 

transcription

repressor inactive

Negative repressible

On

Inactive repressor

Inhibits

Product makes

 

 

 

transcription

repressor active

Positive inducible

Off

Inactive activator

Stimulates

Substrate makes

 

 

 

transcription

activator active

Positive repressible

On

Active activator

Stimulates

Product makes

 

 

 

transcription

activator inactive

the basic unit of transcriptional control in bacteria. Despite the fact that, at the time, no methods were available for determining nucleotide sequences, Jacob and Monod deduced the structure of the operon genetically by analyzing the interactions of mutations that interfered with the nor­mal regulation of lactose metabolism. We will examine the effects of some of these mutations after seeing how the lac operon regulates lactose metabolism.

Lactose (a disaccharide) is one of the major carbohy­drates found in milk; it can be metabolized by E. coli bacte­ria that reside in the gut of mammals. Lactose does not easily diffuse across the E. coli cell membrane and must be actively transported into the cell by the enzyme permease (< Figure 16.6). To utilize lactose as an energy source, E. coli must first break it into glucose and galactose, a reaction cat­alyzed by the enzyme p-galactosidase. This enzyme can also convert lactose into allolactose, a compound that plays an

important role in regulating lactose metabolism. A third enzyme, thiogalactoside transacetylase, also is produced by the lac operon, but its function in lactose metabolism is not yet known.

The enzymes p-galactosidase, permease, and transacety- lase are encoded by adjacent structural genes in the lac operon of E. coli. p-Galactosidase is encoded by the lacZ gene, permease by the lacY gene, and transacetylase by the lacA gene (< Figure 16.7a). When lactose is absent from the medium in which E. coli grows, only a few molecules of each enzyme are produced. If lactose is added to the medium and glucose is absent, the rate of synthesis of all three enzymes simultane­ously increases about a thousandfold within 2 to 3 minutes. This boost in enzyme synthesis results from transcription of lacZ, lacY, and lacA and examplifies coordinate induction, the simultaneous synthesis of several enzymes, stimulated by a specific molecule, the inducer (< Figure 16.7b). Although

Extracellular lactose

Cell membrane

 

also converts lactose into the related compound allolactose...

Glucose

16.6 Lactose, a major carbohydrate found in milk, consists of 2 six-carbon sugars linked together.

Allolactose

a

p-Galactosidase

            A        

.and converts allolactose into galactose and glucose.

■ lac operon 1

(a)

Absence of lactose

Operon

Regulator gene (lacI)

RNA polymerase

lacO operator

Active regulator protein (repressor)

 

Structural genes

lacZ

lacY

lacA

No transcription

(b)

Presence of lactose

Transcription and translation

Active regulator protein

Inactive regulator protein (repressor)

Allolactose

            A        

12 When lactose is present, some of it is converted into allolactose,.

RNA polymerase

lacO operator

<L

 

V

.which then binds to the regulatory protein, making the protein inactive

The regulatory protein cannot bind to the operator,.

and the structural genes are transcribed and translated.

Enzymes

P-Galactosidase

I          

Permease

Transacetylase         J

^^ Glucose

 

actosidase

Lactose

Galactose

16.7 The lac operon regulates lactose metabolism.

a

The enzymes convert lactose into glucose and galactose.

p

lactose appears to be the inducer here, allolactose is actually responsible for induction.

In the lac operon, the lacZ, lacY, and lacA genes have a common promoter (lacP in Figure 16.7a) and are tran­scribed together. Upstream of the promoter is a regulator gene, lacI, which has its own promoter (PI). The lacI gene is transcribed into a short mRNA that is translated into a repressor. Each repressor consists of four identical polypeptides and has two binding sites; one site binds to allolactose and the other binds to DNA. In the absence of lactose (and, therefore, allolactose), the repressor binds to the lac operator site lacO (see Figure 16.7a). Jacob and Monod mapped the operator to a position adjacent to the lacZ gene; more recent nucleotide sequencing has demon­strated that the operator actually overlaps the 3' end of the promoter and the 5' end of lacZ (< Figure 16.8).

Immediately upstream of the structural genes is the lac promoter. RNA polymerase binds to the promoter and moves

down the DNA molecule, transcribing the structural genes. When the repressor is bound to the operator, the binding of RNA polymerase is blocked, and transcription is prevented. When lactose is present, some of it is converted into allolac- tose, which binds to the repressor and causes the repressor to be released from the DNA. In the presence of lactose, then, the repressor is inactivated, the binding of RNA polymerase is no longer blocked, the transcription of lacZ, lacY, and lacA takes place, and the lac enzymes are produced.

Have you spotted the flaw in the explanation just given for the induction of the lac enzymes? You might recall that permease is required to transport lactose into the cell. If the lac operon is repressed and no permease is being produced, how does lactose get into the cell to inactivate the repressor and turn on transcription? Furthermore, the inducer is actually allolactose, which must be produced from lactose by p-galactosidase. If p-galactosidase production is repressed, how can lactose metabolism be induced?

lacZ gene

a

5'

DNA   3'

nontemplate strand

RNA polymerase

lac

repressor

TAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCAC

3' 5'

-35 region (consensus sequence)

-10 region (consensus sequence)

Transcription start site

Operator bound by lac repressor

16.8 In the lac operon, the operator overlaps the promoter and the 5' end of the first structural gene.

The answer is that repression never completely shuts down transcription of the lac operon. Even with active repressor bound to the operator, there is a low level of tran­scription and a few molecules of p-galactosidase, permease, and transacetylase are synthesized. When lactose appears in the medium, the permease that is present transports a small amount of lactose into the cell. There, the few molecules of p-galactosidase that are present convert some of the lactose into allolactose. The allolactose then attaches to the repres- sor and alters its shape so that the repressor no longer binds to the operator. When the operator site is clear, RNA poly- merase can bind and transcribe the structural genes of the lac operon.

Several compounds related to allolactose also can bind to the lac repressor and induce transcription of the lac operon. One such inducer is isopropylthiogalactoside (IPTG). Although IPTG inactivates the repressor and al­lows the transcription of lacZ, lacY, and lacA, IPTG is not metabolized by p-galactosidase; for this reason it is often used in research to examine the effects of induction, inde­pendent of metabolism.

             _

lac Mutations

Jacob and Monod worked out the structure and function of the lac operon by analyzing mutations that affected lactose metabolism. To help define the roles of the different com­ponents of the operon, they used partial diploid strains of

E. coli. The cells of these strains possessed two different DNA molecules: the full bacterial chromosome and an extra piece of DNA. Jacob and Monod created these strains by allowing conjugation to take place between two bacteria (see Chapter 8). In conjugation, a small circular piece of DNA (a plasmid) is transferred from one bacterium to another. The plasmid used by Jacob and Monod contained the lac operon; so the recipient bacterium became partly diploid, possessing two copies of the lac operon. By using different combinations of mutations on the bacterial and plasmid DNA, Jacob and Monod determined that parts of the lac operon were cis acting (able to control the expres­sion of genes on the same piece of DNA only) or trans acting (able to control the expression of genes on other DNA molecules).

Structural-gene mutations Jacob and Monod first dis­covered some mutant strains that had lost the ability to syn­thesize either p-galactosidase or permease. (They did not study in detail the effects of mutations on the transacetylase enzyme, so it will not be considered here.) These mutations mapped to the lacZ or lacY structural genes and altered the amino acid sequence of the enzymes encoded by the genes. These mutations clearly affected the structure of the enzymes and not the regulation of their synthesis.

Through the use of partial diploids, Jacob and Monod were able to establish that mutations at the lacZ and lacY genes were independent and usually affected only the prod­uct of the gene in which they occurred. Partial diploids with lacZ+ lacY- on the bacterial chromosome and lacZ- lacY+ on the plasmid functioned normally, producing p-galactosidase and permease in the presence of lactose. (The genotype of a partial diploid is written by separating the genes on each DNA molecule with a slash: lacZ+ lacY~/lacZ~ lacY+.) In this partial diploid, a single functional p-galactosidase gene (lacZ+) is sufficient to produce p-galactosidase; it makes no difference whether the functional p-galactosidase gene is coupled to a functional (lacY+) or a defective (lacY-) perme­ase gene. The same is true of the lacY+ gene.

Regulator-gene mutations Jacob and Monod also isolated mutations that affected the regulation of enzyme production.

Concepts

The lac operon of E. coli controls the transcription of three genes in lactose metabolism: the lacZ gene, which encodes p-galactosidase; the lacY gene, which encodes permease; and the lacA gene, which encodes thiogalactoside transacetylase. The lac operon is inducible: a regulator gene produces a repressor that binds to the operator site and prevents the transcription of the structural genes. The presence of allolactose inactivates the repressor and allows the transcription of the lac operon.

Absence of lactose

Regulator gene (lacI+)

Active repressor

Mutant repressor

 

Pi

RNA polymerase

| The lac I + gene is trans dominant: the repressor produced by lacI+ can bind to both operators and repress transcription in the absence of lactose.

CannotN.

lacO+ operator

bind

lacZ -

 

 

 

 

(b)

Presence of lactose

Regulator gene (lacI+)

Active repressor

Mutant repressor

 

P ^

When lactose is present, it inactivates the repressor, and functional p-galactosidase is produced from the lacZ+gene.

Lactose

 

V

Inactive repressor

lacO+ operator

 

Nonfunctional p-Galactosidase

16.9 The partial diploid lacl+ lacZ~/lacl~ lacZ+ produces p-galactosidase only in the presence of lactose because the lad gene is trans dominant.

 

p-Galactosidase

These mutations affected the production of both p-galactosi- dase and permease, because genes for both enzymes are in the same operon and are regulated coordinately.

Some of these mutations were constitutive, causing the lac enzymes to be produced all the time, whether lactose was present or not, and these mutations fell into two classes: regulator and operator. Jacob and Monod mapped one class to a site upstream of the structural genes; these mutations occurred in the regulator gene and were designated lacI~. The construction of partial diploids demonstrated that a lacI+ gene was dominant over a lacI~ gene; a single copy of lacI+ (genotype lacI+/lacI~) was sufficient to bring about normal regulation of enzyme production. Furthermore, lacI+ restored normal control to an operon even if the operon was located on a different DNA molecule, showing that lacI was able to act in trans. A partial diploid with genotype lacI+ lacZ~/lacI~ lacZ+ functioned normally, syn­thesizing p-galactosidase only when lactose was present (< Figure 16.9). In this strain, the lacI+ gene on the bacterial chromosome was functional, but the lacZ" gene was defec­

tive; on the plasmid, the lacZ~ gene was defective, but the lacI+ gene was functional. The fact that a lacI+ gene could regulate a lacZ+ gene located on a different DNA molecule indicated to Jacob and Monod that the lacI+ gene product was able to diffuse to either the plasmid or the chromosome.

Some lacI mutations isolated by Jacob and Monod pre­vented transcription from taking place even in the presence of lactose and other inducers such as IPTG. These muta­tions were referred to as superrepressors (lacIs), because they produced repressors that could not be inactivated by an inducer. Recall that the repressor has two binding sites, one for the inducer and one for DNA. The lacIs mutations produced a repressor with an altered inducer-binding site, which made the inducer unable to bind to the repressor; consequently, the repressor was always able to attach to the operator site and prevent transcription of the lac genes. Superrepressor mutations were dominant over lacI+; partial diploids with genotype lacIs lacZ+/lacI+ lacZ+ were unable to synthesize either p-galactosidase or permease, whether or not lactose was present (< Figure 16.10).

lacls

Pi

Super- repressor Active repressor

 

m

Pi

lacI+

The lacIs gene produces a superrepressor that does not bind lactose.

RNA polymerase

Lactose

Inactive repressor

RNA polymerase

Cannot bind

Cannot bind

lacO+ ~ operator

X         lacZ+

lacP+

 

w

X A\\\

 

4 16.10 The partial diploid lacIs IacZ+/lacI+ lacZ+ fails to produce p-galactosidase in the presence and absence of lactose, because the lacIs gene encodes a superrepressor.

The lacIs gene is trans dominant: the superrepressor binds both operators and prevents transcription in the presence and absence of lactose.

Operator mutations Jacob and Monod mapped the other class of constitutive mutants to a site adjacent to lacZ. These mutations occurred at the operator site, and were labeled lacOc (O stands for operator and c for constitutive). The lacOc mutations altered the sequence of DNA at the operator so that the repressor protein was no longer able to bind. A par­tial diploid with genotype lacl+ lacOc lacZ+/lacI+ lacO+ lacZ+ exhibited constitutive synthesis of p-galactosidase, indicating that lacOc was dominant over lacO+.

Analysis of other partial diploids showed that the lacO gene was cis acting, affecting only genes on the same DNA molecule. For example, a partial diploid with genotype lacI+ lacO+ lacZ-/lacI+ lacOc lacZ+ was constitutive, producing p-galactosidase in the presence or absence of lactose (<Figure 16.11a), but a partial diploid with genotype lacI+ lacO+ lacZ+/lacI+ lacOc lacZ- produced p-galactosidase only in the presence of lactose (< Figure 16.11b). In the constitutive partial diploid (lacI+ lacO+ lacZ-/lacI+ lacOc lacZ+; see Figure 16.11a), the lacOc muta­tion and the functional lacZ+ gene are present on the same DNA molecule; but in lacI+ lacO+ lacZ+/lacI+ lacOc lacZ- (see Figure 16.11b), the lacOc mutation and the functional lacZ+ gene are on different molecules. The lacO mutation affects only genes to which it is physically connected, as is true of all operator mutations. They prevent the binding of a repressor protein to the operator and thereby allow RNA polymerase to transcribe genes on the same DNA molecule. However, they cannot prevent a repressor from binding to normal operators on other DNA molecules.

Promoter mutations Mutations affecting lactose metab­olism have also been isolated at the promoter site; these mutations are designated lacP-, and they interfere with the binding of RNA polymerase to the promoter. Because this binding is essential for the transcription of the struc­tural genes, E. coli strains with lacP- mutations don't pro­duce lac enzymes either in the presence or in the absence of lactose. Like operator mutations, lacP- mutations are cis

acting and affect only genes on the same DNA molecule. The partial diploid lacI+ lacP+ lacZ+/lacI+ lacP- lacZ+ exhibits normal synthesis of p-galactosidase, whereas the lacI+ lacP- lacZ+/lacI+ lacP+ lacZ- fails to produce p-galactosidase whether or not lactose is present.

Positive Control and Catabolite Repression

E. coli and many other bacteria will metabolize glucose pref­erentially in the presence of lactose and other sugars. They do so because glucose enters glycolysis without further modification and therefore requires less energy to metabo­lize than do other sugars. When glucose is available, genes that participate in the metabolism of other sugars are repressed, in a phenomenon known as catabolite repres­sion. For example, the efficient transcription of the lac operon takes place only if lactose is present and glucose is absent. But how is the expression of the lac operon influ­enced by glucose? What brings about catabolite repression?

Catabolite repression results from positive control in response to glucose. (This regulation is in addition to the negative control brought about by the repressor binding at the operator site of the lac operon when lactose is absent.) Positive control is accomplished through the binding of a dimeric protein called the catabolite activator protein (CAP) to a site that is about 22 nucleotides long and is located within or slightly upstream of the promoter of the lac genes (< Figure 16.12). RNA polymerase does not bind efficiently to many promoters unless CAP is first bound to the DNA. Before CAP can bind to DNA, it must form a complex with a modified nucleotide called adenosine-3', 5'-cyclic monophosphate (cyclic AMP or cAMP), which is important in cellular signaling processes in both bacterial and eukaryotic cells. In E. coli, the concentration of cAMP is inversely proportional to the level of available glucose. A high concentration of glucose within the cell lowers the amount of cAMP, and so little cAMP-CAP complex is available to bind to the DNA. Subsequently, RNA poly- merase has poor affinity for the lac promoter, and little

(a) Partial diploid lacl+ lacO + lacZ / lacl+ lacOc lacZ+

(b) Partial diploid lacl+ lacO + lacZ +/ lacl+ lacO c lacZ-

Absence of lactose

lacI+

Active repressor

lacI

lacO+ operator

bind y

 

lacO c operator

            I          

Transcription and translation

Absence of lactose

lacI+

\

t

lacI+

Active repressor

lacO+ operator

Cannot bind ' lacZ+

 

lacO c operator

            I          

Transcription and translation

Presence of lactose

lacI+

Active repressor

p-Galactosidase

lacI+

lacO+ operator

Lactose

V

Inactive repressor

 

Presence of lactose

lacI+

Nonfunctional p-Galactosidase

Active repressor

Nonfunctional p-Galactosidase

lacI+

lacOc operator

            I          

Transcription and translation

p-Galactosidase

T

16.11 Mutations in lacO are constitutive and cis acting.

(a)       The partial diploid lacI+ lacO+ lacZ~/lacI+ lacO lacZ+ is constitutive, producing p-galactosidase in the presence and absence of lactose.

(b)       The partial diploid lacI+ lacO+ lacZ+/lacI+ lacO lacZ~ is inducible (produces p-galactosidase only when lactose is present), demonstrating that the lacO gene is cis acting.

lacO+ operator

Lactose

Inactive repressor

 

lacOc operator

            I          

Transcription and translation

Nonfunctional p-Galactosidase

P

transcription of the lac operon takes place. Low concen­trations of glucose stimulate high levels of cAMP, resulting in increased cAMP-CAP binding to DNA. This increase enhances the binding of RNA polymerase to the promoter and increases transcription of the lac genes by some 50-fold.

The catabolite activator protein exerts positive con­trol in more than 20 operons of E. coli. The response to

CAP varies among these promoters; some operons are ac­tivated by low levels of CAP, whereas others require high levels. CAP contains a helix-turn-helix DNA-binding mo­tif and, when it binds at the CAP site, it causes the DNA helix to bend (< Figure 16.13). The bent helix enables CAP to interact directly with the RNA polymerase en­zyme bound to the promoter and facilitate the initiation of transcription.

When glucose is low

a

When glucose level is low, cAMP levels are high.

 

..

CAP readily binds cAMP, and the CAP-cAMP complex binds DNA,.

cAMP cAMP cAMP

cAMP cAMP cAMP

lacI

 

cAMP

CAP

 

The result is high rates of transcription and translation of the structural genes.

Enzymes

p-Galactosidase Permease Transacetylase

I

J

1

 

4

Lactose

Glucose Galactose

_K      

When glucose is high

..

When glucose level is high, cAMP levels are low, and cAMP is less likely to bind to CAP.

..

5| .an< T glucc

and the production of glucose from lactose.

RNA polymerase cannot bind to DNA as efficiently;.

cAMP cAMP

CaP

RNA polymerase

lacO operator

CAP

-X X

..

.so transcription is at a low rate.

Little transcription

416.12 The catabolite activator protein (CAP) binds to the promoter of the lac operon and stimulates transcription.

CAP must complex with cAMP before binding to the promoter of the lac operon. The binding of cAMP-CAP to the promoter activates transcription by facilitating the binding of RNA polymerase. Levels of cAMP are inversely related to glucose: low glucose stimulates high cAMP; high glucose stimulates low cAMP.

Concepts)

In spite of its name, catabolite repression is a type of positive control in the lac operon. CAP, complexed with cAMP, binds to a site near the promoter and stimulates the binding of RNA polymerase. Cellular levels of cAMP in the cell are controlled by glucose; a low glucose level increases the abundance of cAMP and enhances the transcription of the lac structural genes.

www.whfreeman.com/pierce Information on CAP control and the binding of CAP to DNA

The trp Operon of E. coli

The lac operon just discussed is an inducible operon, one in which transcription does not normally take place and must be turned on. Other operons are repressible; tran­scription in these operons is normally turned on and must be repressed. The tryptophan (trp) operon in E. coli, which controls the biosynthesis of the amino acid trypto- phan, is an example of a repressible operon.

The trp operon contains five structural genes (trpE, trpD, trpC, trpB, and trpA), which produce components of three enzymes (two of the enzymes consist of two polypeptide chains). These enzymes convert chorismate into tryptophan (<Figure 16.14). The first structural

 

cAMP-CAP complex

 

Transcription Promoter        start site

4 16.13 Binding of the cAMP-CAP complex to DNA produces a sharp bend in DNA that activates transcription.

gene, trpE, contains a long 5' untranslated region (5' UTR) that is transcribed but does not encode any of these enzymes. Instead, this 5' UTR plays an important role in another regulatory mechanism, discussed in the next sec­tion. Upstream of the structural genes is the trp promoter. When tryptophan levels are low, RNA polymerase binds to the promoter and transcribes the five structural genes into a single mRNA, which is then translated into en­zymes that convert chorismate into tryptophan.

Some distance from the trp operon is a regulator gene, trpR, which encodes a repressor that alone cannot bind DNA (see Figure 16.14). Like the lac repressor, the tryptophan repressor has two binding sites, one that binds to DNA at the operator site and another that binds to tryptophan (the activator). Binding with tryptophan causes a conformational change in the repressor that makes it capable of binding to DNA at the operator site, which overlaps the promoter (see Figure 16.14). When the operator is occupied by the tryptophan repressor, RNA polymerase cannot bind to the promoter and the struc­tural genes cannot be transcribed. Thus, when cellular levels of tryptophan are low, transcription of the trp operon takes place and more tryptophan is synthesized; when cellular levels of tryptophan are high, transcription of the trp operon is inhibited and the synthesis of more tryptophan does not take place.

When tryptophan is low

Regulator gene (trpR)

3

The trp repressor is normally inactive

Inactive regulator protein (repressor)

RNA polymerase

\

Operator

Structural genes

 

5' UTR trpE trpD trpC trpB trpA

1

Transcription and translation

A

.and transcription takes place.

\ \ \ \ \

Enzymes

Chorismate (trp repressor)

- Tryptophan

When tryptophan is high

Operator

 

Inactive regulator protein (repressor)

binds to the operator and shuts transcription off.

4 16.14 The trp operon controls the biosynthesis of the amino acid tryptophan in E. coli.

Concepts]

The trp operon is a repressible operon that controls the biosynthesis of tryptophan. In a repressible operon, transcription is normally turned on and must be repressed. Repression is accomplished through the binding of tryptophan to the repressor, which renders the repressor active. The active repressor binds to the operator and prevents RNA polymerase from transcribing the structural genes.

Attenuation: The Premature Termination of Transcription

We've now seen how both positive and negative control regulate the initiation of transcription in an operon. Some operons have an additional level of control that affects the continuation of transcription rather than its initiation. In attenuation, transcription begins at the start site, but ter­mination takes place prematurely, before the RNA poly- merase even reaches the structural genes. Attenuation oc­curs in a number of operons that code for enzymes participating in the biosynthesis of amino acids.

We can understand the process of attenuation most easily by looking at one of the best-studied examples,

which is found in the trp operon of E. coli. Several obser­vations by Charles Yanofsky and his colleagues in the early 1970s indicated that repression at the operator site is not the only method of regulation in the trp operon. They iso­lated a series of mutants that possessed deletions in the transcribed region of the operon. Some of these mutants exhibited increased levels of transcription, yet control at the operator site was unaffected. Furthermore, they observed that two mRNAs of different sizes were tran­scribed from the trp operon: a long mRNA containing sequences for the structural genes and a much shorter mRNA of only 140 nucleotides. These observations led Yanofsky to propose that another mechanism—one that caused premature termination of transcription—also reg­ulates transcription in the trp operon.

Close examination of the trp operon reveals a region of 162 nucleotides that corresponds to the long 5' UTR of the mRNA (mentioned earlier) transcribed from the trp operon (< Figure 16.15a). The 5' UTR (also called a leader) contains four regions: region 1 is complementary to region 2, region 2 is complementary to region 3, and region 3 is complementary to region 4. These comple­mentarities allow the 5' UTR to fold into two different secondary structures (< Figure 16.15b). Which secondary structure is assumed determines whether attenuation will occur.

(a) Trp operon

Ribosome binding site

5' UTR

a

Regions: 1

5'

(b)

I

Start codon

V Trp codons

UUUUUUU

Gene e

I

3'

i          

Start codon

Trp codons

 

When tryptophan is high, region 3 pairs with region 4. This structure terminates transcription.

UUUUUUU

 

When tryptophan is low, region 2 pairs with region 3. This structure does not terminate transcription.

1+2 and 3+4 secondary structure Attenuation (terminates transcription)

2+3

secondary structure Antitermination

416.15 Two different secondary structures may be formed by the 5' UTR of the mRNA transcript of the trp operon.

2

One of the secondary structures contains one hairpin produced by the base pairing of regions 1 and 2 and another hairpin produced by the base pairing of regions 3 and 4. Notice that a string of uracil nucleotides follows the 3+4 hairpin. Not coincidentally, the structure of a bacterial intrinsic terminator (Chapter 13) includes a hairpin followed by a string of uracil nucleotides; this secondary structure in the 5' UTR of the trp operon is indeed a termi­nator and is called an attenuator. When cellular levels of tryptophan are high, regions 3 and 4 of the 5' UTR base pair, producing the attenuator structure; this base pairing causes transcription to be terminated before the trp struc­tural genes can be transcribed.

The alternative secondary structure of the 5' UTR is produced by the base pairing of regions 2 and 3 (see Figure 16.15b). This base pairing also produces a hairpin, but this hairpin is not followed by a string of uracil nucleotides; so this structure does not function as a terminator. When cel­lular levels of tryptophan are low, regions 2 and 3 base pair, and transcription of the trp structural genes is not termi­nated. RNA polymerase continues past the 5' UTR into the coding section of the structural genes, and the enzymes that synthesize tryptophan are produced. Because it prevents the termination of transcription, the 2+3 structure is called an

antiterminator.

To summarize, the 5' UTR of the trp operon can fold into one of two structures. When tryptophan is high, the 3+ 4 structure forms, transcription is terminated within the 5' UTR, and no additional tryptophan is synthesized. When tryptophan is low, the 2+ 3 structure forms, transcription continues through the structural genes, and tryptophan is synthesized. The critical question, then, is, Why does the 3+ 4 structure arise when tryptophan is high and the 2+ 3 structure when tryptophan is low?

To answer this question, we must take a closer look at the nucleotide sequence of the 5' UTR. At the 5' end, upstream of region 1, is a ribosome-binding site. Region 1 actually encodes a small protein (see Figure 16.15b). Within the coding sequence for this protein are two UGG codons, which specify the amino acid tryptophan; so tryp- tophan is required for the translation of this 5' UTR sequence. The protein encoded by the 5' UTR has not been isolated and is presumed to be unstable; its only ap­parent function is to control attenuation. Although it was stated in Chapter 14 that a 5' UTR is not translated into a protein, the 5' UTR of operons subject to attenuation are exceptions to this rule.

The formation of hairpins in the 5' UTR of the trp operon is controlled by the interplay of transcription and translation that takes place near the 5' end of the mRNA. Recall that, in prokaryotic cells, transcription and transla­tion are coupled: while transcription is taking place at the 3' end of the mRNA, translation is initiated at the 5' end. The precise timing and interaction of these two processes in the 5' UTR determine whether attenuation occurs.

Transcription when tryptophan levels are high Let's

first consider what happens when intracellular levels of tryp- tophan are high. RNA polymerase begins transcribing the DNA, producing region 1 of the 5' UTR (< Figure 16.16a). Following RNA polymerase closely, a ribosome binds to the 5' UTR (at the Shine-Dalgarno sequence, see Chapter 14) and begins to translate the coding region. Meanwhile, RNA polymerase is transcribing region 2 (< Figure 16.16b). Region 2 is complementary to region 1 but, because the ribosome is translating region 1, the nucleotides in regions 1 and 2 cannot base pair. As RNA polymerase begins to tran­scribe region 3, the ribosome is continuing to translate region 1 (< Figure 16.16c). When the ribosome reaches the two UGG tryptophan codons, it doesn't slow or stall, because tryptophan is abundant and tRNAs charged with tryptophan are readily available. This point is critical to note: because tryptophan is abundant, translation can keep up with transcription.

As it moves past region 1 to the stop codon, the ribo­some partly covers region 2; (< Figure 16.16d); meanwhile, RNA polymerase completes the transcription of region 3. Although regions 2 and 3 are complementary, region 2 is partly covered by the ribosome; so it can't base pair with 3.

RNA polymerase continues to move along the DNA, eventually transcribing regions 4 of the 5' UTR. Region 4 is complementary to region 3, and, because region 3 cannot base pair with region 2, it pairs with region 4. The pairing of regions 3 and 4 (see Figure 16.16d) produces the attenua­tor—a hairpin followed by a string of uracil nucleotides— and transcription terminates just beyond region 4. The structural genes are not transcribed, no tryptophan- producing enzymes are translated, and no additional tryp- tophan is synthesized.

Transcription when tryptophan levels are low What

happens when tryptophan levels are low? Once again, RNA polymerase begins transcribing region 1 of the 5' UTR (< Figure 16.16e), and the ribosome binds to the 5' end of the 5' UTR and begins to translate region 1 while RNA poly- merase continues transcribing region 2 (< Figure 16.16f). When the ribosome reaches the UGG tryptophan codons, it stalls (< Figure 16.16g) because the level of tryptophan is low, and tRNAs charged with tryptophan are scarce or even unavailable. The ribosome sits at the tryptophan codons, awaiting the arrival of a tRNA charged with tryptophan. Stalling of the ribosome does not, however, hinder transcrip­tion; RNA polymerase continues to move along the DNA, and transcription gets ahead of translation.

Because the ribosome is stalled at the tryptophan codons in region 1, region 2 is not covered by the ribosome when region 3 has been transcribed. Therefore, nucleotides in region 2 and region 3 base pair, forming the 2+ 3 hairpin (< Figure 16.16h). This hairpin does not cause termination, and so transcription continues. Because region 3 is already paired with region 2, the 3 + 4 hairpin (the attenuator)

When tryptophan is high

(a)

a

RNA polymerase begins transcribing DNA, producing region 1 of the 5' UTR.

(b)

H A ribosome binds to the 5' end of the 5' UTR and begins to translate region 1, while region 2 is being transcribed.

mRNA            RNA polymerase

I Trp codons

DNA

1

Ribosome " 1

2

 

a

a

The ribosome translates region 1 while RNA polymerase transcribes region 3.

The ribosome does not stall at the Trp codons, because tryptophan is abundant.

(d)

^ The leading edge of the ribosome covers part of region 2, preventing it from pairing with region 3.

 

            ••si

^ Region 4 is transcribed and pairs with region 3. The pairing of regions 3 and 4 produces the attenuator that terminates transcription.

When tryptophan is low

(e)

a

RNA polymerase begins transcribing the DNA, producing region 1 of the 5' UTR.

 

(f)

H A ribosome attaches to the 5' end of the 5' UTR and begins to translate region 1

while region 2 is being transcribed.

(g)

a

The ribosome stalls at the Trp codons in region 1 because tryptophan is low.

Because the ribosome is stalled, region 2 is not covered by the ribosome when region 3 is transcribed.

(h) Ti

When region 3 is transcribed, it pairs with region 2.

^ When region 4 is transcribed, it cannot pair with region 3, because region 3 is already paired with region 2; the attenuator never forms, and transcription continues.

 

Trp codons

1'

416.16 The premature termination of transcription (attenuation) takes place in the trp operon, depending on the cellular level of tryptophan.

never forms, and so attenuation does not occur. RNA poly- merase continues along the DNA, past the 5' UTR, tran­scribing all the structural genes into mRNA, which is trans­lated into the enzymes encoded by the trp operon. These enzymes then synthesize more tryptophan. Important

events in the process of attenuation are summarized in Table 16.3.

Several additional points about attenuation need clari­fication. The key factor controlling attenuation is the num­ber of tRNA molecules charged with tryptophan, because

3

4

2

2

2

2

4

lEenrVVBII

Events in the process

of attenuation

 

            1

Intracellular

 

Position of Ribosome

Secondary

Termination of

Level of

Ribosome Stalls When Region 3

Structure

Transcription

Tryptophan

at Trp Codons

Is Transcribed

of 5' UTR

of trp Operon

High

No

Covers region 2

3 + 4 hairpin

Yes

Low

Yes

Covers region 1

2 + 3 hairpin

No

their availability is what determines whether the ribosome stalls at the tryptophan codons. A second point concerns the synchronization of transcription and translation, which is critical to attenuation. Synchronization is achieved through a pause site located in region 1 of the 5' UTR. After initiating transcription, RNA polymerase stops temporarily at this site, which allows time for a ribosome to bind to the 5' end of the mRNA so that translation can closely follow transcription. A third point is that ribosomes do not tra­verse the convoluted hairpins of the 5' UTR to translate the structural genes. Ribosomes that attach to the ribosome- binding site at the 5' end of the mRNA encounter a stop codon at the end of region 1. Ribosomes translating the structural genes attach to a different ribosome-binding site located near the beginning of the trpE gene.

Why does attenuation occur? Why do bacteria need attenuation in the trp operon? Shouldn't repression at the operator site prevent transcription from taking place when tryptophan levels in the cell are high? Why does the cell have two types of control? Part of the answer is that repres­sion is never complete; some transcription is initiated even when the trp repressor is active; repression reduces tran­scription only as much as 70-fold. Attenuation can further reduce transcription another 8- to 10-fold; so together the two processes are capable of reducing transcription of the trp operon more than 600-fold. Both mechanisms provide E. coli with a much finer degree of control over tryptophan synthesis than either could achieve alone.

Another reason for the dual control is that attenuation and repression respond to different signals: repression responds to the cellular levels of tryptophan, whereas attenu­ation responds to the number of tRNAs charged with trypto- phan. There may be times when it is advantageous for the cell to be able to respond to these different signals. Finally, the trp repressor affects several operons other than the trp operon. It's possible that at an earlier stage in the evolution of E. coli, the trp operon was controlled only by attenuation. The trp repressor may have evolved primarily to control the other operons and only incidentally affects the trp operon.

Attenuation is a complex process to grasp because you must simultaneously visualize how two dynamic processes — transcription and translation—interact, and it's easy to get the two processes confused. Remember that attenuation

entails the early termination of transcription, not translation (although events in translation bring about the termination of transcription). Attenuation often causes confusion because we know that transcription must precede translation. We're comfortable with the idea that transcription might affect translation, but it's harder to imagine that the effects of trans­lation could influence transcription, as it does in attenuation. The reality is that transcription and translation are closely coupled in prokaryotic cells, and events in one process can easily affect the other.

Concepts       9

In attenuation, transcription is initiated but terminates prematurely. When tryptophan levels are low, the ribosome stalls at the tryptophan codons and transcription continues. When tryptophan levels are high, the ribosome does not stall at the tryptophan codons, and the 5' UTR adopts a secondary structure that terminates transcription before the structural genes can be copied into RNA (attenuation).

www.whfreeman.com/pierce More information on attenuation

Antisense RNA in Gene Regulation

All the regulators of gene expression that we have consid­ered so far have been proteins. Several examples of RNA regulators have also been discovered. These small RNA mol­ecules are complementary to particular sequences on mRNAs and are called antisense RNA. They control gene expression by binding to sequences on mRNA and inhibit­ing translation.

Translational control by antisense RNA is seen in the regulation of the ompF gene of E. coli (< Figure 16.17a). Two E. coli genes, ompF and ompC, produce outer-membrane proteins that function as diffusion pores, allowing bacteria to adapt to external osmolarities (the tendency of water to move across a membrane owing to different ion concentra­tions). Under most conditions, both the ompF and the ompC genes are transcribed and translated. When the osmolarity of the medium increases, a regulator gene named micF—for

(a)

Low osmolarity

mRNA

 

When extracellular osmolarity is low,.

(b)

ompFgene

High osmolarity

micF gene

1

Transcription

 

.the ompF gene is transcribed and translated to produce OmpF protein.

Ribosome

OmpF protein

416.17 Antisense RNA can regulate translation.

When extracellular osmolarity is high,.

1

Transcription

Antisense RNA

mRNA

 

.the micF gene is activated and micF RNA is produced.

^ micF RNA pairs with the 5' end of ompF RNA, blocking the ribosome-binding site and preventing translation.

1

Thus, no OmpF protein is produced.

ompF gene

1

Transcription

 

 

\ Translation

X i

 

No translation

5

5

'

mRNA-interfering complementary RNA—is activated and micF RNA is produced (< Figure 16.17b). The micF RNA, an antisense RNA, binds to a complementary sequence in the 5' UTR of the ompF mRNA and inhibits the binding of the ribosome. This inhibition reduces the amount of transla­tion (see Figure 16.17b), which results in fewer OmpF proteins in the outer membrane and thus reduces the detri­mental movement of substances across the membrane owing to the changes in osmolarity. A number of examples of anti- sense RNA controlling gene expression have now been iden­tified in bacteria and bacteriophages.

Transcriptional Control in Bacteriophage Lambda

Bacteriophage X is a virus that infects the bacterium E. coli (Chapter 8). Bacteriophage X possesses a single DNA chro­mosome consisting of 48,502 nucleotides surrounded by a protein coat. A bacteriophage infects a bacterial cell by attaching to the cell wall and injecting its DNA into the cell. Inside the cell, X phage undergoes either of two life cycles.

In the lytic cycle (see Chapter 8), phage genes are tran­scribed and translated to produce phage coat proteins and enzymes that synthesize from 100 to 200 copies of the phage DNA. The viral components are assembled to produce phage

particles, and the phage produces a protein that causes the cell to lyse. The released phage can then infect other bacterial cells. In the lysogenic cycle, phage genes that encode replica­tion enzymes and phage proteins are not immediately tran­scribed. Instead, the phage DNA integrates into the bacterial chromosome as a prophage. When the bacterial chromo­some replicates, the prophage is duplicated along with the bacterial genes and is passed to the daughter cells in bacterial reproduction. The prophage may later excise from the bacte­rial chromosome and enter the lytic cycle.

Whether a X phage enters the lytic or the lysogenic cycle depends on the regulation of the phage genes. In the lytic cycle, the genes that encode replication enzymes, phage proteins, and bacterial cell lysis are transcribed; but, in the lysogenic cycle, these genes are repressed.

Like bacterial genes, functionally related phage genes are clustered together into operons. There are four major operons in the phage X chromosome (< Figure 16.18). The early right operon contains genes that are required for DNA replication and are transcribed early in the lytic cycle. The early left operon contains genes necessary for recombina­tion and the integration of phage DNA into the bacterial chromosome as a part of the lysogenic cycle. A third operon, the late operon, contains genes that encode the pro­tein coat of the phage, produced late in the lytic cycle. The fourth operon is the repressor operon, which produces the X repressor responsible for maintaining the prophage DNA in a dormant state. Although there are several additional promoters on the X chromosome that may be activated at special times, here the emphasis is on three general features of transcriptional control in bacteriophage X.

First, both positive control and negative control are seen in X gene regulation. Several proteins act as repressors, inhibiting transcription, whereas others act as activators,

                                   

Concepts       EH

Antisense RNA is complementary to other RNA or DNA sequences. In bacterial cells, it may inhibit translation by binding to sequences in the 5' UTR of mRNA and preventing the attachment of the ribosome.

Regulator of early left genes

Repressor operon

Genes for integrating viral DNA into bacterial chromosome

 

Regulator of %

Phage DNA replication proteins

Regulator of late genes

Genes for lysis proteins

Genes for viral head proteins

Genes for viral tail proteins

4 16.18 The bacteriophage X chromosome contains four major operons: the early left operon, the early right operon, the late operon, and the repressor operon.

stimulating transcription. The X repressor, which plays a major role in X gene regulation, can act as either an activator or a repressor.

A second feature is that transcription is accomplished through a cascade of reactions. As one operon is tran­scribed, it produces a protein that regulates the transcrip­tion of a second operon, which produces a protein that affects the transcription of a third operon. Thus, the oper- ons are activated and repressed in a particular order, with the use of several different promoters, each with an affinity for specific activators and repressors. As each promoter is activated, only the genes under its control are transcribed;

this controlled transcription ensures that genes appropriate to each stage of the lytic or lysogenic cycle are expressed.

A third feature of X gene regulation is the use of tran- scriptional antiterminator proteins, which bind to RNA polymerase and alter its structure, allowing it to ignore cer­tain terminators (< Figure 16.19a). In the absence of the antiterminator protein, RNA polymerase stops at a termina­tor located early in the operon (<Figure 16.19b), and so only some of the genes in the operon are transcribed and translated.

Concepts]"

The entry of bacteriophage X into lysis or lysogeny is controlled by a cascade of reactions, in which the transcription of operons is turned on and off in a specific sequence. The expression of the operons is controlled by the affinity of different promoters for repressor and activator proteins and through transcriptional antiterminators.

 

Eukaryotic Gene Regulation

Many features of gene regulation are common to both bacterial and eukaryotic cells. For example, in both types of cells, DNA-binding proteins influence the ability of RNA polymerase to initiate transcription. However, there are also some differences, although these differences are often a matter of degree. First, eukaryotic genes are not organized into operons and are rarely transcribed to­gether into a single mRNA molecule; instead, each struc­tural gene typically has its own promoter and is tran­scribed separately. Second, chromatin structure affects gene expression in eukaryotic cells; DNA must unwind

(a)

Antiterminator present

RNA polymerase

\

Antiterminator

Long mRNA

Terminator 1

Terminator 2

 

RNA polymerase reads through terminator 1 .

.and transcribes a longer mRNA.

.that codes for proteins A and B.

(b)

Antiterminator absent

RNA polymerase

Terminator 1 Terminator 2 Gene A / Gene B /

Bi Promoter^

416.19 Antiterminator proteins bind to RNA polymerase and alter its structure so that it ignores certain terminators.

Transcription

Short mRNA

Translation

i

r

Protein A

 

RNA polymerase stops at terminator 1.

A short mRNA is produced that codes for protein A.

from the histone proteins before transcription can take place. Third, although both repressors and activators function in eukaryotic and bacterial gene regulation, acti­vators seem to be more common in eukaryotic cells. Fi­nally, the regulation of gene expression in eukaryotic cells is characterized by a greater diversity of mechanisms that act at different points in the transfer of information from DNA to protein.

Eukaryotic gene regulation is less well understood than bacterial regulation, partly owing to the larger genomes in eukaryotes, their greater sequence complexity, and the diffi­culty of isolating and manipulating mutations that can be used in the study of gene regulation. Nevertheless, great advances in our understanding of the regulation of eukary- otic genes have been made in recent years, and eukaryotic regulation continues to be one of the cutting-edge areas of research in genetics.

Chromatin Structure and Gene Regulation

One type of gene control in eukaryotic cells is accom­plished through the modification of gene structure. In the nucleus, histone proteins associate to form octamers, around which helical DNA tightly coils to create chro­matin (see Figure 11.5). In a general sense, this chromatin structure represses gene expression. For a gene to be tran­scribed, transcription factors, activators, and RNA poly- merase must bind to the DNA. How can these events take place with DNA wrapped tightly around histone proteins? The answer is that before transcription, chromatin struc­ture changes, and the DNA becomes more accessible to the transcriptional machinery.

DNase I hypersensitivity Several types of changes are observed in chromatin structure when genes become tran- scriptionally active. One type is an increase in the sensitivity of chromatin to degradation by DNase I, an enzyme that digests DNA. When tightly bound by histone proteins, DNA is resistant to DNase I digestion because the enzyme cannot gain access to the DNA. When DNA is less tightly bound by histones, it becomes sensitive to DNase I degradation. Thus, the ability of DNase I to digest DNA provides an indication of the DNA-histone association.

As genes become transcriptionally active, regions around the genes become highly sensitive to the action of DNase I (see Chapter 11). These regions, called DNase I hy­persensitive sites, frequently develop about 1000 nu- cleotides upstream of the start site of transcription, suggest­ing that the chromatin in these regions adopts a more open configuration during transcription. This relaxation of the chromatin structure may allow regulatory proteins access to binding sites on the DNA. Indeed, many DNase I hypersen­sitive sites correspond to known binding sites for regulatory proteins.

Histone protein

DNA

Positively charged tail

 

ffi Positively charged tails of nucleosomal histone proteins probably interact with the negatively charged phosphates of DNA.

|2 Acetylation of the tails weakens their interaction with DNA and may permit some transcription factors to bind to DNA.

416.20 The acetylation of histone proteins alters chromatin structure and permits some transcription factors to bind to DNA.

Histone acetylation One factor affecting chromatin structure is acetylation, the addition of acetyl groups (CH3CO) to histone proteins. Histones in the octamer core of the nucleosome have two domains: (1) a globular domain that associates with other histones and the DNA and (2) a positively charged tail domain that probably inter­acts with the negatively charged phosphates on the back­bone of DNA (« Figure 16.20).

Acetyl groups are added to histone proteins by acteyl- transferase enzymes; the acetyl groups destabilize the nu- cleosome structure, perhaps by neutralizing the positive charges on the histone tails and allowing the DNA to sepa­rate from the histones. Other enzymes called deacetylases strip acetyl groups from histones and restore chromatin repression. Certain transcription factors (see Chapter 13) and other proteins that regulate transcription either have acteyltransferase activity or attract acteyltransferases to the DNA.

Some transcription factors and other regulatory proteins are known to alter chromatin structure without acetylating histone proteins. These chromatin-remodeling complexes bind directly to particular sites on DNA and reposition the nucleosomes, allowing transcription factors to bind to pro­moters and initiate transcription.

DNA methylation Another change in chromatin struc­ture associated with transcription is the methylation of cytosine bases, which yields 5-methylcytosine (see Figure 10.19). Heavily methylated DNA is associated with the repression of transcription in vertebrates and plants, whereas transcriptionally active DNA is usually unmethy- lated in these organisms.

DNA methylation is most common on cytosine bases adjacent to guanine nucleotides on the same strand (CpG); so two methylated cytosines sit diagonally across from each other on opposing strands:

•           • •GC• • •

•           • •CG• • •

DNA regions with many CpG sequences are called CpG islands and are commonly found near transcription start sites. While genes are not being transcribed, these CpG islands are often methylated, but the methyl groups are removed before the initiation of transcription. CpG meth- ylation is also associated with long-term gene repression, such as on the inactivated X chromosome of female mam­mals (see Chapter 4).

Recent evidence suggests an association between DNA methylation and the deacetylation of histones, both of which repress transcription. Certain proteins that bind tightly to methylated CpG sequences form complexes with other proteins that act as histone deacetylases. In other words, methylation appears to attract deacetylases, which remove acetyl groups from the histone tails, stabilizing the nucleosome structure and repressing transcription. De- methylation of DNA would allow acetyltransferases to remove these acetyl groups, disrupting nucleosome struc­ture and permitting transcription.

Concepts]

Sensitivity to DNase I digestion suggests that transcribed DNA assumes an open configuration before transcription. The acetylation of histone proteins disrupts nucleosome structure and may facilitate transcription. The activation of transcription is often preceded by demethylation of DNA; methylated sequences may attract deacetylases, which remove acetyl groups from histone proteins, stabilizing chromatin structure and repressing transcription.

Transcriptional Control in Eukaryotic Cells

Transcription is an important level of control in eukaryotic cells, and this control requires a number of different types of proteins and regulatory elements. The initiation of eukaryotic transcription was discussed in detail in Chapter 13. Recall that general transcription factors and RNA polymerase assemble into a basal transcription apparatus, which binds to a core promoter located immediately upstream of a gene. The basal transcription apparatus is capable of minimal levels of tran­scription; transcriptional activator proteins are required to bring about normal levels of transcription. These proteins bind to a regulatory promoter, which is located upstream of the core promoter, and to enhancers, which may be located some distance from the gene (< Figure 16.21).

Transcriptional activators, coactivators and repressors

Transcriptional activator proteins stimulate transcription by facilitating the assembly or action of the basal transcription apparatus at the core promoter; the activators may interact directly with the basal transcription apparatus or indirectly

Activator binding site

(regulatory promoter)

.           Aj        

DNA

Transcription factors, RNA polymerase, and transcriptional activator proteins bind DNA and stimulate transcription.

DNA

 

Transcriptional activator protein

Core promoter

TATA box

Transcription start

RNA

polymerase

TATA

 

Y

Basal transcription apparatus

116.21 Transcriptional activator proteins bind to sites on DNA and stimulate transcription. Most act by stimulating or stabilizing the assembly of the basal transcription apparatus.

through protein coactivators. Some activators and coactiva- tors, as well as the general transcription factors, also have acteyltransferase activity and facilitate transcription further by altering chromatin structure (see earlier subsection on histone acetylation).

Transcriptional activator proteins have two distinct functions (see Figure 16.21). First, they are capable of bind­ing DNA at a specific base sequence, usually a consensus sequence in a regulatory promoter or enhancer; for this function, most transcriptional activator proteins contain one or more of the DNA-binding motifs discussed at the beginning of this chapter. A second function is the ability to interact with other components of the transcriptional appa­ratus and influence the rate of transcription. Most do so by either stabilizing or stimulating the assembly of the basal transcription apparatus.

GAL4 is a transcription activator protein that regulates the transcription of several yeast genes in galactose metabo­lism. GAL4 contains several zinc fingers and binds to a DNA sequence called UASG (upstream activating sequence for GAL4). UASG exhibits the properties of an enhancer— a regulatory sequence that may be some distance from the regulated gene and is independent of the gene in position and orientation (see Chapter 13). When bound to UASG, GAL4 stimulates the transcription of yeast genes needed for metabolizing galactose.

A particular region of GAL4 binds another protein called GAL80, which regulates the activity of GAL4 in the presence of galactose. When galactose is absent, GAL80 binds to GAL4 (two molecules of GAL80 bind to each mol­ecule of GAL4), preventing GAL4 from activating transcrip­tion (< Figure 16.22). When galactose is present, however, it binds to GAL80, causing a conformational change in the protein so that it can no longer bind GAL4. The GAL4 pro­tein is then available to activate the transcription of the genes whose products metabolize galactose.

GAL4 and a number of other transcriptional activator proteins contain multiple amino acids with negative charges that form an acidic activation domain. These acidic activa­tors stimulate transcription by enhancing the ability of TFIIB (see Chapter 13), one of the general transcription factors, to join the basal transcription apparatus. Without the activator, the binding of TFIIB is a slow process; the ac­tivator helps "recruit" TFIIB to the initiation complex, thereby stimulating the binding of RNA polymerase and the initiation of transcription. Acidic activators may also en­hance other steps in the assembly of the basal transcription apparatus.

Some regulatory proteins in eukaryotic cells act as repressors, inhibiting transcription. These repressors may bind to sequences in the regulatory promoter or to distant sequences called silencers, which, like enhancers, are posi­tion and orientation independent. Unlike repressors in bac­teria, most eukaryotic repressors do not directly block RNA polymerase. These repressors may compete with activators for DNA binding sites: when a site is occupied by an activa-

UASg

Absence of galactose

GAL80 GAL4

Presence of galactose

Galactose

£ J) GAL80

 

UASg

UASg

_L

^ GAL4 stimulates the

transcription of galactose- metabolizing genes.

Transcription of genes not stimulated

Protein

Transcription of genes stimulated

416.22 Transcription is activated by GAL4 in response to galactose. GAL4 binds to the UASG site and controls the transcription of genes in galactose metabolism.

tor, transcription is stimulated, but, if a repressor occupies that site, no activation occurs. Alternatively, a repressor may bind to sites near an activator site and prevent the activator from contacting the basal transcription apparatus. A third possible mechanism of repressor action is direct interfer­ence with the assembly of the basal transcription apparatus, thereby blocking the initiation of transcription.

Concepts]"

Transcriptional regulatory proteins in eukaryotic cells can influence the initiation of transcription by affecting the stability or assembly of the basal transcription apparatus. Some regulatory proteins are activators and stimulate transcription; others are repressors and inhibit transcription.

 

Enhancers and insulators Enhancers are capable of affecting transcription at distant promoters. For example, an enhancer that regulates the gene encoding the alpha chain of the T-cell receptor is located 69,000 bp down-

i 16.23 An

insulator blocks the action of an enhancer on a promoter when the insulator lies between the enhancer and the promoter.

^ Enhancer I can stimulate translation of gene A but its effect on gene B is blocked by the insulator.

 

T

Gene A

Promoter

Transcription start

Enhancer I

Insulator

binding

protein

1 X

Insulator

^ Enhancer II can stimulate translation of gene B but its effect on gene A is blocked by the insulator.

 

Enhancer II

Transcription start

stream of the gene's promoter. Furthermore, the exact posi­tion and orientation of an enhancer relative to the promoter can vary. How can an enhancer affect the initiation of tran­scription taking place at a promoter that is tens of thou­sands of base pairs away? The mechanism of action of many enhancers is not known, but evidence suggest that, in some cases, activator proteins bind to the enhancer and cause the DNA between the enhancer and the promoter to loop out, bringing the promoter and enhancer close to one another, so that the transcriptional activator proteins are able to directly interact with the basal transcription apparatus at the core promoter.

Most enhancers are capable of stimulating any pro­moter in their vicinities. Their effects are limited, how­ever, by insulators (also called boundary elements), which are DNA sequences that block or insulate the effect of enhancers in a position-dependent manner. If the insu­lator lies between the enhancer and the promoter, it blocks the action of the enhancer; but, if the insulator lies outside the region between the two, it has no effect (< Figure 16.23). Specific proteins bind to insulators and play a role in their blocking activity, but exactly how this takes place is poorly understood. Some insulators also limit the spread of changes in chromatin structure that

affect transcription.              

Concepts       B

Some activator proteins bind to enhancers, which are regulatory elements that are distant from the gene whose transcription they stimulate. Insulators are DNA sequences that block the action of enhancers.

Coordinated gene regulation Although eukaryotic cells do not possess operons, several eukaryotic genes may be activated by the same stimulus. For example, many eukaryotic cells respond to extreme heat and other stresses by producing heat-shock proteins that help to prevent damage from such stressing agents. Heat-shock proteins are produced by approx­imately 20 different genes. During times of environmental stress, the transcription of all the heat-shock genes is greatly elevated. Groups of bacterial genes are often coordinately ex­pressed (turned on and off together) because they are physi­cally clustered as an operon and have the same promoter, but coordinately expressed genes in eukaryotic cells are not clus­tered. How, then, is the transcription of eukaryotic genes co- ordinately controlled if they are not organized into an operon?

Genes that are coordinately expressed in eukaryotic cells are able to respond to the same stimulus because they have regulatory sequences in common in their promoters or en­hancers. For example, different eukaryotic heat-shock genes possess a common regulatory element upstream of their start sites. A transcriptional activator protein binds to this regula­tory element during stress and elevates transcription. Such common DNA regulatory sequences are called response ele­ments; they typically contain short consensus sequences (Table 16.4) at varying distances from the gene being regulated.

A single eukaryotic gene may be regulated by several dif­ferent response elements. The metallothionein gene protects cells from the toxicity of heavy metals by encoding a protein that binds to heavy metals and removes them from cells. The basal transcription apparatus assembles around the TATA box, just upstream of the transcription start site for the metalloth- ionein gene, but the apparatus alone is capable of only low rates of transcription. The presence of heavy metals stimulates much higher rates of transcription.

lable 16.4 A few response elements found in eukaryotic cells

Response Element

Responds to

Consensus Sequence

Heat-shock element

Heat and other stress

CNNGAANNTCCNNG

Glucocorticoid response element

Glucocorticoids

TGGTACAAATGTTCT

Phorbol ester response element

Phorbal esters

TGACTCA

Serum response element

Serum

CCATATTAGG

Source: Adapted from B. Lewin, Genes IV (Oxford: Oxford University Press, 1994), p. 880.

Enhancer

GRE

l

MRE

Enhancer

,           *                      

TRE

I

MRE

TATA

l

+1

Metallothionein gene

t

Steroid

receptor

protein

MRE activator protein

API

MRE activator protein

Transcription start

RNA

polymerase

Various proteins may bind to upstream response elements to stimulate transcription.

Transcription factors

Basal transcription apparatus

4 16.24 Multiple response elements (MREs) are found in the upstream region of the metallothionein gene. The basal transcription apparatus binds near the TATA box. In response to heavy metals, activator proteins bind to several MRE elements and stimulate transcription. The TRE response element is the binding site for transcription factor API. In response to glucocorticoid hormones, steroid receptors bind to the GRE response element located approximately 250 nucleotides upstream of the metallothionein gene and stimulate transcription.

Other response elements found upstream of the metal- lothionein gene also contribute to increasing its rate of transcription. For example, several copies of a metal re­sponse element (MRE) are upstream of the metallothio- nein gene (< Figure 16.24). Heavy metals stimulate the binding of an activator protein to MREs, which elevates the rate of transcription of the metallothionein gene. The pres­ence of multiple copies of this response element permits high rates of transcription to be induced by metals. Two enhancers also are located in the upstream region of the metallothionein gene; one enhancer contains a response element known as TRE, which stimulates transcription in the presence of phorbol esters. A third response element called GRE is located approximately 250 nucleotides upstream of the metallothionein gene and stimulates tran­scription in response to glucocorticoid hormones.

This example illustrates a common feature of eukary- otic transcriptional control: a single gene may be activated by several different response elements, found in both pro­moters and enhancers. Multiple response elements allow the same gene to be activated by different stimuli. At the same time, the presence of the same response element in different genes allows a single stimulus to activate multiple genes. In this way, response elements allow complex biochemical responses in eukaryotic cells.

Gene Control Through Messenger RNA Processing

Alternative splicing allows a pre-mRNA to be spliced in multiple ways, generating different proteins in different tis­sues or at different times in development (see Chapter 14). Many eukaryotic genes undergo alternative splicing, and the regulation of splicing is probably an important means of controlling gene expression in eukaryotic cells.

The T-antigen gene of the mammalian virus SV40 serves as a well-studied example of alternative splicing. This gene is capable of encoding two different proteins, the large T and small t antigens. Which of the two proteins is pro­duced depends on which of two alternative 5' splice sites is used during RNA splicing (< Figure 16.25). The use of one 5' splice site produces mRNA that encodes the large T

ffi Use of the first 5' splice site produces an mRNA that encodes the large T antigen.

Pre-mRNA 5'|

Alternative 5' splice sites ,

■Intron

^ Use of the second 5' splice site produces an mRNA that encodes the small t antigen.

3'

C

a

The SF2 protein enhances the use of the second splice site.

mRNA processing

<sf7

mRNA

 

Intron

mRNA

 

ron

5'

3' 5'

 

1 f

Large T antigen        Small t antigen

16.25 Alternative splicing leads to the production of the small t antigen and the large T antigen in the mammalian virus SV40.

XX genotype

X:A = 1.0

Sxl gene

Female Fly

Tra-2 protein

Sxl protein

 

XY genotype

X:A = 0.5

Sxl gene

ffi In X:A = 0.5 embryos, the Sxl gene is not activated,.

No Sxl protein

tra pre-mRNA ■

Nonfunctional Tra protein

.and no Sxl protein is produced.

^ Thus tra pre-mRNA is spliced at an upstream site,.

^ .producing a nonfunctional Tra protein.

Male Fly

dsx pre-mRNA—► Dsx^protein

 

^ Without Tra, the male- specific splicing of dsx pre-mRNA.

                        I \

^ .produces male Dsx proteins that cause the embryo to develop into a male.

t 16.26 Alternative splicing controls sex determination in Drosophila.

antigen, whereas the use of the other 5' splice site (which is farther downstream) produces an mRNA encoding the small t antigen.

A protein called splicing factor 2 (SF2) enhances the production of mRNA encoding the small t antigen (see Figure 16.25). Splicing factor 2 has two binding domains: one is an RNA-binding region and the other has alternat­ing serine and arginine amino acids. These two domains are typical of SR proteins, which often play a role in regu­lating splicing. Splicing factor 2 stimulates the binding of U1 snRNP to the 5' splice site, one of the earliest steps in RNA splicing (see Chapter 14). The precise mechanism by which SR proteins influence the choice of splice sites is poorly understood. One model suggests that SF2 and other SR proteins bind to specific splice sites on mRNA and stimulate the attachment of snRNPs, which then commit the site to splicing.

Another example of alternative mRNA splicing that regulates the expression of genes controls whether a fruit fly develops as male or female. Sex differentiation in Drosophila arises from a cascade of gene regulation (< Figure 16.26). When the ratio of X chromosomes to the number of haploid sets of autosomes (the X; A ratio; see Chapter 4) is 1, a female-specific promoter is activated early in devel­opment and stimulates the transcription of the sex-lethal (Sxl) gene. The protein encoded by Sxl regulates the splicing of the pre-mRNA transcribed from another gene called transformer (tra). The splicing of tra pre-mRNA results in the production of Tra protein. Together with another pro­tein (Tra-2), Tra stimulates the female-specific splicing of

pre-mRNA from yet another gene called doublesex (dsx). This event produces a female-specific Dsx protein, which causes the embryo to develop female characteristics.

In male embryos, which have an X;A ratio of 0.5 (see Figure 16.26), the promoter that transcribes the Sxl gene in females is inactive; so no Sxl protein is produced. In the absence of Sxl protein, Tra pre-mRNA is spliced at a differ­ent 3' splice site to produce a nonfunctional form of Tra protein (< Figure 16.27). In turn, the presence of this non­functional Tra in males causes Dsx pre-mRNAs to be spliced differently (see Figure 16.26), and a male-specific Dsx protein is produced. This event causes the development of male-specific traits.

In summary, the Tra, Tra-2, and Sxl proteins regulate alternative splicing that produces male and female pheno- types in Drosophila. Exactly how these proteins regulate alternative splicing is not yet known, but it's possible that the Sxl protein (produced only in females) may block the upstream splice site on the tra pre-mRNA. This block­age would force the spliceosome to use the downstream 3' splice site, which causes the production of Tra protein

and eventually results in female traits (see Figure 16.27).                     

Concepts       B

Eukaryotic genes may be regulated through the control of mRNA processing. The selection of alternative splice sites leads to the production of different proteins.

tra pre-mRNA 5'

ij In males, the

Alternative 3' splice sites A  B C

3'

Intron

Intron

In females, the presence of Sxl protein.

mRNA 5'

 

No functional Tra protein is produced

Male phenotype

Female phenotype

 

/ y        * i

/

416.27 Alternative splicing of tra pre-mRNA. Two

alternative 3' splice sites are present.

Gene Control Through RNA Stability

The amount of a protein that is synthesized depends on the amount of corresponding mRNA available for translation. The amount of available mRNA, in turn, depends on both the rate of mRNA synthesis and the rate of mRNA degrada­tion. Eukaryotic mRNAs are generally more stable than bac­terial mRNAs, which typically last only a few minutes before being degraded, but nonetheless there is great variability in the stability of eukaryotic mRNA: some persist for only a few minutes; others last for hours, days, or even months. These variations can result in large differences in the amount of protein that is synthesized.

Cellular RNA is degraded by ribonucleases, enzymes that specifically break down RNA. Most eukaryotic cells contain 10 or more types of ribonucleases, and there are several different pathways of mRNA degradation. In one pathway, the 5' cap is first removed, followed by 5': 3'

removal of nucleotides. A second pathway begins at the 3' end of the mRNA and removes nucleotides in the 3': 5' direction. In a third pathway, the mRNA can be cleaved at internal sites.

Messenger RNA degradation from the 5' end is most common and begins with the removal of the 5' cap. This pathway is usually preceded by the shortening of the poly(A) tail. Poly(A)-binding proteins (PABPs) normally bind to the poly(A) tail and contribute to its stability-enhancing effect. The presence of these proteins at the 3' end of the mRNA protects the 5' cap. When the poly(A) tail has been short­ened below a critical limit, the 5' cap is removed, and nucle- ases then degrade the mRNA by removing nucleotides from the 5' end. These observations suggest that the 5' cap and 3' poly(A) tail of eukaryotic mRNA physically interact with each other, most likely by the poly(A) tail bending around so that the PABPs make contact with the 5' cap (see Chapter 14). Other parts of eukaryotic mRNA, including sequences in the 5' UTR, the coding region, and the 3' UTR, also affect mRNA stability.

Poly(A) tails are added to the 3' ends of some bacterial mRNAs, but they are shorter than those typically associated with eukaryotic mRNA and have the opposite effect; they appear to destabilize most prokaryotic mRNAs.

Concepts

The stability of mRNA influences gene expression by affecting the amount of mRNA available to be translated. The stability of mRNA is affected by the 5' cap, the poly(A) tail, the 5' UTR, the coding section, and the 3' UTR.

 

RNA Silencing

Recent evidence indicates that the expression of some genes may be suppressed through RNA silencing, also known as RNA interference and posttranscriptional gene silencing. Although many of the details of this mechanism are still poorly understood, it appears to be widespread, existing in fungi, plants, and animals. It may also prove to be a power­ful tool for artificially regulating gene expression in geneti­cally engineered organisms.

RNA silencing is initiated by the presence of double- stranded RNA, which may arise in several ways: by the tran­scription of inverted repeats in DNA into a single RNA molecule that base pairs with itself; by the simultaneous transcription of two different RNA molecules that are com­plementary to one another and pair; or by the replication of double-stranded RNA viruses (< Figure 16.28a). In Drosophila, an enzyme called Dicer cleaves and proces­ses the double-stranded RNA to produce small pieces of single-stranded RNA that range in length from 21 to 25 nucleotides (< Figure 16.28b). These small interfering

RNAs (siRNAs) then pair with complementary sequences in mRNA and attract an RNA - protein complex that cleaves the mRNA approximately in the middle of the bound siRNA. After cleavage, the mRNA is further degraded. In

(a)

DNA

Inverted repeat

 

AGTCC GGACT

 

1

 

 

Transcription

 

RNA

' r

 

UCAGG CCUGA

Transcription through an inverted repeat in the DNA.

Folds

5'

(b)

rt Double-stranded RNA is cleaved and processed by the enzyme dicer.

.produces an RNA molecule that folds to produce double- stranded RNA.

^ siRNAs may also attach to complementary sequences in DNA and attract methylating enzymes.

DNA

.to produce small interfering RNAs (siRNAs).

 

mRNA

^ siRNA pairs with complementary sequences on mRNA.

RNA-protein complex

Methylating enzyme

| .and attracts an RNA-protein complex that cleaves the mRNA in the middle of the bound siRNA.

 

 

Cleavage

 

r

Methylated

DNA DNA

a

After cleavage, the RNA is degraded.

^ .which methylate cytosine bases in the DNA, affecting transcription.

Degradation

Conclusion: siRNAs produced from double- stranded RNA molecules affect gene expression.

the nucleus, siRNAs serve as guides for the methylation of complementary sequences in DNA, which then affects tran­scription. Some related RNA molecules produced through the cleavage of double-stranded RNA bind to complemen­tary sequences in the 3' UTR of mRNA and inhibit their translation.

RNA silencing is thought to have evolved as a defense against RNA viruses and transposable elements that move through an RNA intermediate (see Chapter 20). The extent to which it contributes to normal gene regulation is uncertain, but dramatic phenotypic effects result from some mutations that occur in the enzymes that carry out RNA silencing.

Concepts]"

RNA silencing is initiated by double-stranded RNA molecules that are cleaved and processed. The resulting small interfering RNAs bind to complementary sequences in mRNA and bring about their cleavage and degradation. Small interfering RNAs may also stimulate the methylation of complementary sequences in DNA.

H

Translational and Posttranslational Control

Ribosomes, aminoacyl tRNAs, initiation factors, and elon­gation factors are all required for the translation of mRNA molecules. The availability of these components affects the rate of translation and therefore influences gene expression. The initiation of translation in some mRNAs is regulated by proteins that bind to the mRNA's 5' UTR and inhibit the binding of ribosomes, similar to the way in which repressor proteins bind to operators and prevent the transcription of structural genes.

Many eukaryotic proteins are extensively modified after translation by the selective cleavage and trimming of amino acids from the ends, by acetylation, or by the addition of phosphates, carboxyl groups, methyl groups, and carbohy­drates to the protein). These modifications affect the trans­port, function, and activity of the proteins and have the capacity to affect gene expression.

Concepts]"

The initiation of translation may be affected by proteins that bind to specific sequences at the 5' end of mRNA. The availability of ribosomes, tRNAs, initiation and elongation factors, and other components of the translational apparatus may affect the rate of translation.

ir"

116.28 RNA silencing leads to the degradation of mRNA and the methylation of DNA.

5'

''

5'

3'

 

Connecting Concepts)

A Comparison of Bacterial and Eukaryotic Gene Control

Now that we have considered the major types of gene reg­ulation, let's review some of the similarities and differ­ences of bacterial and eukaryotic gene control.

1.         Much of gene regulation in both bacterial and eukaryotic cells is accomplished through proteins that bind to specific sequences in DNA. Regulatory proteins come in a variety of types, but most can be characterized according to a small set of DNA-binding motifs.

2.         Regulatory proteins that affect transcription exhibit two basic types of control: repressors inhibit transcrip­tion (negative control); activators stimulate transcrip­tion (positive control). Both negative control and posi­tive control are found in bacterial and eukaryotic cells.

3.         Complex biochemical and developmental events in bacterial and eukaryotic cells may require a cascade of gene regulation, in which the activation of one set of genes stimulates the activation of another set.

4.         Most gene regulation in bacterial cells is at the level of transcription (although it does exist at other levels). Gene regulation in eukaryotic cells often takes place at multiple levels, including chromatin structure, transcription, mRNA processing, and RNA stability.

5.         In bacterial cells, genes are often clustered in operons and are coordinately expressed by transcription into a single mRNA molecule. In contrast, each eukaryotic gene typically has its own promoter and is transcribed independently. Coordinate regulation in eukaryotic cells takes place through common response elements, present in the promoters and enhancers of the genes. Different genes that have the same response element in common are influenced by the same regulatory protein.

6.         Chromatin structure plays a role in eukaryotic (but not bacterial) gene regulation. In general, condensed chromatin represses gene expression; chromatin structure must be altered before transcription. Acetylation of the histone proteins, which may be influenced by the degree of DNA methylation, appears to be important in bringing about these changes in chromatin structure.

7.         The initiation of transcription is a relatively simple process in bacterial cells, and regulatory proteins function by blocking or stimulating the binding of RNA polymerase to DNA. Eukaryotic transcription requires complex machinery that includes RNA polymerase, general transcription factors, and transcriptional activators, which allows transcription to be influenced by multiple factors.

8.         Some eukaryotic transcriptional activator proteins function at a distance from the gene by binding to enhancers, causing a loop in the DNA, and bringing the promoter and enhancer into close proximity. Some distant-acting sequences analogous to enhancers have been described in bacterial cells, but they appear to be less common.

9.         The greater time lag between transcription and translation in eukaryotic cells than in bacterial cells allows mRNA stability and mRNA processing to play larger roles in eukaryotic gene regulation.

           

Connecting Concepts Across Chapters 9

The focus of this chapter has been on how the flow of information from genotype to phenotype is controlled. We have seen that there are a number of potential points of control in this pathway of information flow, including changes in gene structure, transcription, mRNA process­ing, mRNA stability, translation, and posttranslational modifications.

Gene regulation is critically important from a num­ber of perspectives. It is essential to the survival of cells, which cannot afford to simultaneously transcribe and translate all of their genes. The evolution of complex genomes consisting of thousands of genes would not have been possible without some mechanism to selectively con­trol gene expression. Gene regulation is also important from a practical point of view. A number of human dis­eases are caused by the breakdown of gene regulation, which produces proteins at inappropriate times or places. Gene regulation is also important to genetic engineering, where the key to success is often not getting genes into a cell, which is relatively easy, but getting them expressed at useful levels. For all of these reasons, there is tremen­dous interest in how gene expression is controlled, and understanding gene regulation is one of the frontiers of genetic research.

Information presented in this chapter builds on the foundation of molecular genetics developed in Chapters 10 through 15. The mechanisms of gene regulation pro­vide important links to several topics in subsequent chapters. Gene regulation is important to the success of recombinant DNA, which is discussed in Chapter 18. Gene regulation also plays an important role in the ge­netics of development and cancer, which are discussed in Chapter 21.

CONCEPTS SUMMARY]  

•           Gene expression may be controlled at different levels, including the alteration of gene structure, transcription, mRNA processing, RNA stability, translation, and posttranslational modification. Much of gene regulation is through the action of regulatory proteins binding to specific sequences in DNA.

•           Genes in bacterial cells are typically clustered into operons— groups of functionally related structural genes and the sequences that control their transcription. Structural genes in an operon are transcribed together as a single mRNA.

•           In negative control, a repressor protein binds to DNA and inhibits transcription. In positive control, an activator protein binds to DNA and stimulates transcription. In inducible operons, transcription is normally off and must be turned on; in repressible operons, transcription is normally on and must be turned off.

•           The lac operon of E. coli is a negative inducible operon that controls the metabolism of lactose. In the absence of lactose, a repressor binds to the operator and prevents transcription of the structural genes that encode p-galactosidase, permease, and transacetylase. When lactose is present, some of it is converted into allolactose, which binds to the repressor and makes it inactive, allowing the structural genes to be transcribed and lactose to be metabolized. When all the lactose has been metabolized, the repressor once again binds to the operator and blocks transcription.

•           Positive control in the lac operon and other operons is through catabolite repression. When complexed with cAMP, the catabolite activator protein (CAP) binds to a site in or near the promoter and stimulates the transcription of the structural genes. Levels of cAMP are indirectly correlated with glucose; so low levels of glucose stimulate transcription and high levels inhibit transcription.

•           The trp operon of E. coli is a negative repressible operon that controls the biosynthesis of tryptophan.

•           Attenuation is another level of control that allows transcription to be stopped before RNA polymerase has reached the structural genes. It takes place through the close coupling of transcription and translation and depends on the secondary structure of the 5' UTR sequence.

•           Small RNA molecules, called antisense RNA, are complementary to sequences in mRNA and may inhibit

translation by binding to these sequences, thereby preventing the attachment or progress of the ribosome.

•           Transcriptional control regulates the lytic and lysogenic cycles of bacteriophage X. The transcription of certain operons stimulates the transcription of some operons and represses the transcription of others. Which operons are stimulated and which are repressed depends on the affinity of promoters for repressor and activator proteins.

•           Like gene regulation in bacterial cells, much of eukaryotic regulation is accomplished through the binding of regulatory proteins to DNA. However, there are no operons in eukaryotic cells, and gene regulation is characterized by

a greater diversity of mechanisms acting at different levels.

•           In eukaryotic cells, chromatin structure represses gene expression. During transcription, chromatin structure may be altered by the acetylation of histone proteins and demethylation.

•           The initiation of eukaryotic transcription is controlled by general transcription factors that assemble into the basal transcription apparatus and by transcriptional activator proteins that stimulate normal levels of transcription by binding to regulatory promoters and enhancers.

•           Some DNA sequences limit the action of enhancers by blocking their action in a position-dependent manner.

•           Coordinately controlled genes in eukaryotic cells respond to the same factors because they have common response elements that are stimulated by the same transcriptional activator.

•           Gene expression in eukaryotic cells may be influenced by RNA processing.

•           Gene expression may be regulated by changes in RNA stability. The 5' cap, the coding sequence, the 3' UTR, and the poly(A) tail are important in controlling the stability of eukaryotic mRNAs. Proteins binding to the 5' end of eukaryotic mRNA may affect its translation.

•           RNA silencing takes place when double-stranded RNA is cleaved and processed to produce small interfering RNAs that bind to complementary mRNAs and bring about their cleavage and degradation.

•           Control of the posttranslational modification of proteins also may play a role in gene expression.

[important terms

gene regulation (p. 000) induction (p. 000) structural gene (p. 000) regulatory gene (p. 000) regulatory element (p. 000)

domain (p. 000) operon (p. 000) regulator gene (p. 000) regulator protein (p. 000) operator (p. 000)

negative control (p. 000) positive control (p. 000) inducible operon (p. 000) inducer (p. 000) allosteric protein (p. 000)

repressible operon (p. 000) corepressor (p. 000) coordinate induction (p. 000) partial diploid (p. 000) constitutive mutation (p. 000)

catabolite repression (p. 000) catabolite activator protein

(CAP) (p. 000) adenosine-3', 5'-cyclic monophosphate (cAMP) (p. 000) attenuation (p. 000)

attenuator (p. 000) antiterminator (p. 000) antisense RNA (p. 000) transcriptional antiterminator

protein (p. 000) DNase I hypersensitive site (p. 000)

chromatin-remodeling

complex (p. 000) CpG island (p. 000) coactivator (p. 000) insulator (p. 000) heat-shock protein (p. 000) response element (p. 000)

SR protein (p. 000) RNA silencing (p. 000) small interfering RNAs (siRNAs) (p. 000)

Worked Problems

1. A regulator gene produces a repressor in an inducible operon. A geneticist isolates several constitutive mutations affecting this operon. Where might these constitutive mutations occur? How would the mutations cause the operon to be constitutive?

• Solution

An inducible operon is normally not being transcribed, meaning that the repressor is active and binds to the operator, inhibiting transcription. Transcription takes place when the inducer binds to the repressor, making it unable to bind to the operator.

Genotype of strain

(a)       lacI+ lacP+ lacO+ lacZ+ lacY+

(b)       lacI+ lacP+ lacOc lacZ— lacY+

(c)        lacI+ lacP— lacO+ lacZ+ lacY—

(d)       lacI+ lacP+ lacO+ lacZ— lacY— / lacI~ lacP+ lacO+ lacZ+ lacY+

Constitutive mutations cause transcription to take place at all times, whether the inducer is present or not. Constitutive muta­tions might occur in the regulator gene, altering the repressor so that it is never able to bind to the operator. Alternatively, constitutive mutations might occur in the operator, altering the binding site for the repressor so that the repressor is unable to bind under any conditions.

; 2. For E. coli strains with the lac genotypes, use a plus sign (+) to ; indicate the synthesis of p-galactosidase and permease and a minus sign (—) to indicate no synthesis of the enzymes.

Lactose absent         Lactose present

P-Galactosidase Permease p-Galactosidase Permease

Solution

Genotype of strain

(a)       lacI+ lacP+ lacO+ lacZ+ lacY+

(b)       lacI+ lacP+ lacOc lacZ— lacY+

(c)        lacI+ lacP— lacO+ lacZ— lacY+

(d)       lacI+ lacP+ lacO+ lacZ— lacY—/ lacI— lacP+ lacO+ lacZ+ lacY+

Lactose absent

Lactose present

P-Galactosidase Permease P-Galactosidase Permease

(a)       All the genes possess normal sequences, and so the lac operon functions normally: when lactose is absent, the regulator protein binds to the operator and inhibits the transcription of the structural genes, and so p-galactosidase and permease are not produced. When lactose is present, some of it is converted into allolactose, which binds to the repressor and makes it inactive; the repressor does not bind to the operator, and so the structural genes are transcribed, and p-galactosidase and permease are produced.

(b)       The structural lacZ gene is mutated; so p-galactosidase will not be produced under any conditions. The lacO gene has a constitutive mutation, which means that the repressor is

unable to bind to it, and so transcription takes place at all times. Therefore, permease will be produced in both the presence and the absence of lactose.

(c)        In this strain, the promoter is mutated, and so RNA polymerase is unable to bind and transcription does not take place. Therefore p-galactosidase and permease are not produced under any conditions.

(d)       This strain is a partial diploid, which consists of two copies of the lac operon—one on the bacterial chromosome and another on a plasmid. The lac operon represented in the upper part of the genotype has mutations in both the lacZ and lacY genes, and so it

is not capable of encoding p-galactosidase or permease under any conditions. The lac operon in the lower part of the genotype has a defective regulator gene, but the normal regulator gene in the upper operon produces a diffusible repressor (trans acting) that binds to the lower operon in the absence of lactose and inhibits transcription. Therefore no p-galactosidase or permease is pro­duced when lactose is absent. In the presence of lactose, the repressor cannot bind to the operator, and so the lower operon is transcribed and p-galactosidase and permease are produced.

'. The fox operon, which has sequences A, B, C, and D, encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D have the following effects, where a plus sign ( + ) = enzyme synthesized and a minus sign (—) = enzyme not synthesized.

Fox absent

Fox present

Enzyme 1

Enzyme 2

Enzyme 1

Enzyme 2

Mutation in sequence

No mutation A B C D

(a)       Is the fox operon inducible or repressible?

(b)       Indicate which sequence (A, B, C, or D) is part of the following components of the operon:

Regulator gene Promoter

Structural gene for enzyme 1 Structural gene for enzyme 2

(a)       When no mutations are present, enzymes 1 and 2 are produced in the presence of Fox but not in its absence, indicating that the operon is inducible and Fox is the inducer.

(b)       Mutation A allows the production of enzyme 2 in the presence of Fox, but enzyme 1 is not produced in the presence or absence of Fox, and so A must have a mutation in the structural gene for enzyme 1. With B, neither enzyme is produced under any conditions, and so this mutation most likely occurs in the promoter and prevents RNA polymerase from binding. Mutation C affects only enzyme 2, which is not produced in the presence or absence of lactose; enzyme 1 is produced normally (only in the presence of Fox), and so mutation C most likely occurs in the structural gene for enzyme 2. Mutation D is constitutive, allowing the production of enzymes 1 and 2 whether or not Fox is present. This mutation most likely occurs in the regulator gene, producing a defective repressor that is unable to bind to the operator under any conditions.

Regulator gene Promoter

Structural gene for enzyme 1 Structural gene for enzyme 2

D B A C

• Solution

Because the structural genes in an operon are coordinately expre­ssed, mutations that affect only one enzyme are likely to occur in the structural genes; mutations that affect both enzymes must occur in the promoter or regulator.

4. A mutation occurs in the 5' UTR of the trp operon that reduces the ability of region 2 to pair with region 3. What would be the effect of this mutation when the tryptophan level is high and when the tryptophan level is low?

• Solution

When the tryptophan level is high, regions 2 and 3 do not normally pair, and therefore the mutation will have no effect. When the tryptophan level is low, however, the ribosome normally stalls at the Trp codons in region 1 and does not cover region 2, and so regions 2 and 3 are free to pair, which prevents regions 3 and 4 from pairing and forming a terminator, ending transcription. If regions 2 and 3 cannot pair, then regions 3 and 4 will pair even when tryptophan is low and attenuation will always occur. Therefore, no more tryptophan will be synthesized even in the absence of tryptophan.

The New Genetics

MINING GENOMES

Microarray Analysis and the Analysis of Gene Expression

This exercise introduces the powerful technique of microarray analysis, one of the most potent tools in bioinformatics. After

a general introduction to microarrays, you will explore the use of microarrays in studies of gene expression. You will use SAGE (Serial Analysis of Gene Expression) to try to identify which genes are important in the development of specific diseases.

COMPREHENSION QUESTIONS

 

Name six different levels at which gene expression might be * 2. Draw a picture illustrating the general structure of an controlled.    operon and identify its parts.

3. What is the difference between positive and negative control? What is the difference between inducible and repressible operons?

*           4. Briefly describe the lac operon and how it controls the

metabolism of lactose.

5. What is catabolite repression? How does it allow a bacterial cell to use glucose in preference to other sugars?

*           6. What is attenuation? What is the mechanism by which the

attenuator forms when tryptophan levels are high and the antiterminator forms when tryptophan levels are low?

*           7. What is antisense RNA? How does it control gene expression?

8. What general features of transcriptional control are found in bacteriophage X?

*           9. What changes take place in chromatin structure and what

role do these changes play in eukaryotic gene regulation?

10.       Briefly explain how transcriptional activator proteins and repressors affect the level of transcription of eukaryotic genes.

11.       What is an insulator?

12.       What is a response element? How do response elements bring about the coordinated expression of eukaryotic genes?

13.       Outline the role of alternative splicing in the control of sex differentiation in Drosophila.

*14. What role does RNA stability play in gene regulation? What controls RNA stability in eukaryotic cells?

15. Define RNA silencing. Explain how siRNAs arise and how they potentially affect gene expression.

*16. Compare and contrast bacterial and eukaryotic gene

regulation. How are they similar? How are they different?

APPLICATION QUESTIONS AND PROBLEMS

*17. For each of the following types of transcriptional control, indicate whether the protein produced by the regulator gene will be synthesized initially as an active repressor, inactive repressor, active activator, or inactive activator.

(a)       Negative control in a repressible operon

(b)       Positive control in a repressible operon

(c)        Negative control in an inducible operon

(d)       Positive control in an inducible operon

*18. A mutation occurs at the operator site that prevents the regulator protein from binding. What effect will this mutation have in the following types of operons?

(a)       Regulator protein is a repressor in a repressible operon.

(b)       Regulator protein is a repressor in an inducible operon. 19. The blob operon produces enzymes that convert compound

A into compound B. The operon is controlled by a regulatory gene S. Normally the enzymes are synthesized only in the absence of compound B. If gene S is mutated, the enzymes are synthesized in the presence and in the absence of compound B. Does gene S produce a repressor or an activator? Is this operon inducible or repressible?

*20.

21.

A mutation prevents the catabolite activator protein (CAP) from binding to the promoter in the lac operon. What will be the effect of this mutation on transcription of the operon?

Under which of the following conditions would a lac operon produce the greatest amount of p-galactosidase? The least? Explain your reasoning.

Condition 1 Condition 2 Condition 3 Condition 4

Lactose present

Yes No Yes No

Glucose present

No Yes Yes No

22.

*23.

A mutant strain of E. coli produces p-galactosidase in the presence and in the absence of lactose. Where in the operon might the mutation in this strain occur?

For E. coli strains with the following lac genotypes, use a plus sign ( + ) to indicate the synthesis of p-galactosidase and permease and a minus sign ( —) to indicate no synthesis of the enzymes.

Lactose absent

Lactose present

Genotype of strain

lacI+ lacP+ lacO+ lacZ+ lacY+ lacI— lacP+ lacO+ lacZ+ lacY+ lacI+ lacP+ lacOc lacZ+ lacY+ lacI— lacP+ lacO+ lacZ+ lacY— lacI— lacP— lacO+ lacZ+ lacY+

lacI+ lacP+ lacO+ lacZ— lacY+/ lacI— lacP+ lacO+ lacZ+ lacY—

p-Galactosidase Permease p-Galactosidase Permease

(continued on p. 469)

*23. (continued)        Lactose absent         Lactose present

Genotype of strain    p-Galactosidase Permease p-Galactosidase Permease

lacI

lacP+

lacOc

lacZ+

lacY+/

lacI+

lacP+

lacO+

lacZ"

lacY—

lacI—

lacP+

lacO+

lacZ+

lacY—/

lacI+

lacP—

lacO+

lacZ"

' lacY+

lacI+

lacP—

lacOc

lacZ—

lacY+/

lacI—

lacP+

lacO+

lacZ+

lacY—

lacI+

lacP+

lacO+

lacZ+

' lacY+ /

lacI+

lacP+

lacO+

lacZ+

' lacY+

lacIs

lacP+

lacO+

lacZ+

lacY—/

lacI+

lacP+

lacO+

lacZ"

' lacY+

lacIs

lacP—

lacO+

lacZ—

lacY+ /

lacI+

lacP+

lacO+

lacZ+

' lacY+

24. Give all possible genotypes of a lac operon that produces p-galactosidase and permease under the following conditions. Do not give partial diploid genotypes.

Lactose absent         Lactose present

p-Galactosidase Permease p-Galactosidase       Permease

(a)       — — +            +

(b)       — — —          +

(c)        — — +            —

(d)       + + +   +

(e)       — — —          —

(f)         + — +  — (g) — + — +

*25. Explain why mutations in the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects.

*26. The mmm operon, which has sequences A, B, C, and D, encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D have the following effects, where a plus sign (+) = enzyme synthesized and a minus sign (—) = enzyme not synthesized.

Mmm absent

Mmm present

Mutation         Enzyme          Enzyme          Enzyme          Enzyme

in sequence   1          2          1          2

No mutation   +          +          —        —

A         —        +          —        —

B         +          +          +          +

C         +          —        —        —

D         —        —        —        —

(a) Is the mmm operon        inducible or repressible?

(b) Indicate which sequence (A, B, C, or D) is part of the following components of the operon:

Regulator gene                    

Promoter                   

Structural gene for enzyme 1                     

Structural gene for enzyme 2         

*27. Listed in parts a through g are some mutations that were found in the 5' UTR region of the trp operon of E. coli. What would the most likely effect of each of these mutations be on the transcription of the trp structural genes?

(a)       A mutation that prevented the binding of the ribosome to the 5' end of the mRNA 5' UTR

(b)       A mutation that changed the tryptophan codons in region 1 of the mRNA 5' UTR into codons for alanine

(c)        A mutation that created a stop codon early in region 1 of the mRNA 5' UTR

(d)       Deletions in region 2 of the mRNA 5' UTR

(e)       Deletions in region 3 of the mRNA 5' UTR

(f)         Deletions in region 4 of the mRNA 5' UTR

(g)       Deletion of the string of adenine nucleotides that follows region 4 in the 5' UTR

28.       Some mutations in the trp 5' UTR region increase termination by the attenuator. Where might these mutations occur and how might they affect the attenuator?

29.       Some of the mutations mentioned in Question 28 have an interesting property. They prevent the formation of the antiterminator that normally takes place when the tryptophan level is low. In one of the mutations, the AUG start codon for the 5' UTR peptide has been deleted. How might this mutation prevent antitermination from occurring?

30. Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?

*31. What would be the effect of deleting the Sxl gene in a newly fertilized Drosophila embryo?

32. What would be the effect of a mutation that destroyed the ability of poly(A)-binding protein (PABP) to attach to a poly(A) tail?

Популярные книги

Популярные статьи

10
Описание ссылки 1 | Описание ссылки 2 | Описание ссылки 3 | Описание ссылки 4